ID: 1062117621

View in Genome Browser
Species Human (GRCh38)
Location 9:134817872-134817894
Sequence CCACCCTCTGGGCTCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 391}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062117621_1062117633 15 Left 1062117621 9:134817872-134817894 CCCCAGGGGAGCCCAGAGGGTGG 0: 1
1: 0
2: 4
3: 39
4: 391
Right 1062117633 9:134817910-134817932 GTGGGCAGAGATGTCCATGGAGG 0: 1
1: 0
2: 2
3: 21
4: 259
1062117621_1062117632 12 Left 1062117621 9:134817872-134817894 CCCCAGGGGAGCCCAGAGGGTGG 0: 1
1: 0
2: 4
3: 39
4: 391
Right 1062117632 9:134817907-134817929 CGTGTGGGCAGAGATGTCCATGG 0: 1
1: 0
2: 2
3: 15
4: 177
1062117621_1062117630 -4 Left 1062117621 9:134817872-134817894 CCCCAGGGGAGCCCAGAGGGTGG 0: 1
1: 0
2: 4
3: 39
4: 391
Right 1062117630 9:134817891-134817913 GTGGGGAGTGGACAAGCGTGTGG 0: 1
1: 0
2: 2
3: 28
4: 270
1062117621_1062117634 25 Left 1062117621 9:134817872-134817894 CCCCAGGGGAGCCCAGAGGGTGG 0: 1
1: 0
2: 4
3: 39
4: 391
Right 1062117634 9:134817920-134817942 ATGTCCATGGAGGCTGAGAGTGG 0: 1
1: 0
2: 6
3: 90
4: 738
1062117621_1062117631 -3 Left 1062117621 9:134817872-134817894 CCCCAGGGGAGCCCAGAGGGTGG 0: 1
1: 0
2: 4
3: 39
4: 391
Right 1062117631 9:134817892-134817914 TGGGGAGTGGACAAGCGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062117621 Original CRISPR CCACCCTCTGGGCTCCCCTG GGG (reversed) Intronic
900137053 1:1122128-1122150 CCACCCTCCGCCCTCCCCTGTGG + Intergenic
900412470 1:2519034-2519056 CCACCCTCCAGGCCTCCCTGGGG + Intronic
900592736 1:3467253-3467275 CCACCTTCTGGGTTCCCTCGGGG - Exonic
901878760 1:12181758-12181780 CCACCCTCTGCTCTCTCCAGAGG + Intronic
902033479 1:13439530-13439552 CCACCCCGTGGGCTCCTGTGCGG + Intergenic
902796476 1:18803912-18803934 CTGGCCCCTGGGCTCCCCTGGGG - Intergenic
902832756 1:19028384-19028406 CCACCGTCTGGGCTCCCAGGAGG - Intergenic
902923428 1:19680566-19680588 CCTGCCTCTGGCCTTCCCTGGGG + Intergenic
903215146 1:21839591-21839613 CCACCCTCTGCGGGTCCCTGAGG - Intronic
903382665 1:22907832-22907854 CCTGGCTCTGGGCTCCCCTGGGG - Intronic
903961274 1:27059235-27059257 CCTCCCTCCTGTCTCCCCTGCGG - Intergenic
904420774 1:30389809-30389831 CCTCCCTCCAGGCTCCCCTGTGG - Intergenic
905902760 1:41592637-41592659 CCATCCTCTTGGCTTCTCTGGGG + Intronic
906667381 1:47631505-47631527 CGCCCCTCTGTCCTCCCCTGGGG + Intergenic
907400436 1:54221910-54221932 CCGCCCTCTGGGAGCTCCTGGGG + Intronic
907786569 1:57618572-57618594 CCACCGTCTAAGCTCCCCTGTGG - Intronic
911090482 1:94013404-94013426 CCTGCCTCTGGGCCCCACTGGGG - Intronic
912480717 1:109980521-109980543 CCACCCTCTGGGGGTCCCTAAGG + Intergenic
913069147 1:115284028-115284050 CCTCCCTCTCGGCTGCCCAGGGG + Intergenic
915466094 1:156098928-156098950 ACAGCCTCTGGGCACCCCAGGGG - Intronic
916577336 1:166079469-166079491 CCACCCTCTGGCCACCCCGTGGG - Intronic
917795548 1:178530303-178530325 CCACCTTCTGGGCTGGCCTGTGG - Intronic
918791998 1:188841252-188841274 CCACTCCATGGGCTCCCGTGCGG - Intergenic
919886754 1:201940532-201940554 CCACCCTCAGTGCTGCCCTCTGG - Intronic
921624526 1:217363710-217363732 CCACCTTGTGAGCTGCCCTGTGG + Intergenic
923392580 1:233528808-233528830 CCACCCACTGGGCTCTTCTACGG + Intergenic
1063096932 10:2916304-2916326 CACACCTCTGGGCTCCACTGGGG - Intergenic
1063769737 10:9183632-9183654 CCACCCCGTGGGCTCCTGTGCGG + Intergenic
1064491253 10:15859958-15859980 CCATCCTCCGGGCTGCCCTTCGG - Intronic
1065322776 10:24524521-24524543 CCACGCGCAGAGCTCCCCTGTGG + Exonic
1067393290 10:45885883-45885905 CCAACATCTGGGCTCCTCAGGGG - Intergenic
1067861612 10:49855013-49855035 CCAACATCTGGGCTCCTCAGGGG - Intronic
1069565645 10:69461707-69461729 CCAGCCTCTGGCCCACCCTGTGG + Intronic
1069578862 10:69551441-69551463 CTCCCCACTGGGCTCGCCTGAGG - Intergenic
1069861458 10:71474209-71474231 CCACCCTGAGGGCTCCCTGGAGG - Intronic
1069863664 10:71486885-71486907 CGACCCTCTGGGGAGCCCTGGGG + Intronic
1070399569 10:76041580-76041602 CCTCCCTCTGGGCTCAGCTGCGG - Intronic
1072733514 10:97864111-97864133 CTTCCCTCAGGGCTGCCCTGTGG + Intronic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1074034423 10:109724118-109724140 CCATCCTCTGGAATCCCCAGGGG - Intergenic
1074493669 10:113960280-113960302 GCACCCACGGAGCTCCCCTGGGG - Intergenic
1075726374 10:124612903-124612925 CCCTGCTCTGGGCTCCCCAGGGG - Intronic
1075922339 10:126224163-126224185 GCCCTCTCTGGGCTCCCCTGAGG - Intronic
1076508319 10:130993597-130993619 CCAGCCCCTTGGCTCTCCTGGGG - Intergenic
1076668261 10:132104978-132105000 CCTCCCTCCTGCCTCCCCTGGGG + Intronic
1076787291 10:132757673-132757695 CCAGCCTCTCTGCTCCGCTGTGG - Intronic
1076853406 10:133103887-133103909 CCATCCTCTGGGGTTCCCTGGGG + Intronic
1077034974 11:490176-490198 CAACCCTCTGGCCGCCTCTGCGG + Intronic
1077136321 11:1001100-1001122 CCACCCTGTGGTTCCCCCTGAGG + Intronic
1077235487 11:1480174-1480196 GCACCTTCTGGGCCCCACTGGGG + Intronic
1077444819 11:2586066-2586088 CCACCCTCTGGGCACCTCAGCGG - Intronic
1077498068 11:2896345-2896367 CCAACCTGTGGACTCCCTTGAGG - Intronic
1077498198 11:2896869-2896891 CCCCTCACTGGGCTCCACTGTGG - Intronic
1077764629 11:5144679-5144701 CCACCCCTTGGGCTCCTGTGCGG + Intergenic
1078570524 11:12453848-12453870 CCATCCCTTGGGCTCCACTGTGG - Intronic
1081652129 11:44831470-44831492 CCAAGTTCTGGGTTCCCCTGGGG - Intronic
1083306880 11:61766039-61766061 CCACCACCTGAGCCCCCCTGGGG + Exonic
1083328991 11:61888406-61888428 CCAACCCCTGGTCTACCCTGTGG + Intronic
1083765270 11:64838570-64838592 CCTCCCTCTGAAGTCCCCTGGGG - Intronic
1084149261 11:67280629-67280651 CCACTCCCTGGGGTCCCGTGAGG - Intronic
1084179173 11:67438091-67438113 CCACCCTCCCGCCTCCTCTGGGG + Exonic
1084400909 11:68942412-68942434 CCACCCGTGCGGCTCCCCTGAGG + Intergenic
1084419587 11:69053632-69053654 CCACCCAATCGGCTCCCCAGAGG - Intronic
1084676379 11:70637783-70637805 CCACACTCTAGGCTGCCCAGGGG + Intronic
1084719582 11:70895622-70895644 GCATCCTCTCGGCTCCCCTCTGG - Intronic
1085329369 11:75635134-75635156 GCAGCCTCTGGGTTCCCCTGGGG + Intronic
1087069612 11:94064801-94064823 CCATGCTCTGGGCTCACCTCAGG - Intronic
1088991865 11:114960871-114960893 CCACCTTCTGGCTTCCACTGAGG - Intergenic
1089128092 11:116191439-116191461 CCAGCCACTGGGCTTCCCTGGGG - Intergenic
1089373529 11:117978564-117978586 CCACTCCATGGGCTCCTCTGAGG - Intergenic
1089455847 11:118625376-118625398 TCACCCTCTAGGGTACCCTGAGG + Intronic
1089540642 11:119187454-119187476 GCACCCTCTGGGCTCACCATGGG - Exonic
1089614751 11:119688903-119688925 CCACCCTCTTGCATCCTCTGAGG - Intronic
1089912394 11:122114755-122114777 CCAGCTTCTGAGCTGCCCTGCGG + Intergenic
1090604180 11:128404428-128404450 CCACCCTCTCAGCTCCCCTAAGG - Intergenic
1090782759 11:130021912-130021934 CCACTCCGTGGGCTCCCGTGCGG + Intergenic
1090866379 11:130704315-130704337 CCACCCTAGTGGCTCCTCTGTGG - Intronic
1091283899 11:134397530-134397552 CTGCCCTCTGGCCCCCCCTGTGG - Intronic
1091654799 12:2337793-2337815 CCAGCTTCTGGCCTCCCCAGTGG - Intronic
1092131188 12:6114380-6114402 GCGACCTCCGGGCTCCCCTGTGG - Intronic
1092135243 12:6142480-6142502 CCACTCCATGGGCTCCCGTGTGG + Intergenic
1092428601 12:8392168-8392190 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1092429681 12:8398312-8398334 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1092562032 12:9625650-9625672 CCACCTTCTGGGCTCTATTGTGG + Intergenic
1092843161 12:12562214-12562236 CCGCCCTCTCGGCTCCGCGGCGG - Exonic
1093746009 12:22741818-22741840 CCACCCTCAGGGCAACCCTGAGG - Intergenic
1096109389 12:49020162-49020184 TCACCCTCTGGCTCCCCCTGGGG + Exonic
1096156231 12:49342806-49342828 ACTCCCTCTCGGCTCCCCTCGGG - Intergenic
1096631120 12:52927361-52927383 CCACCCTTGGGCCTCCCCTGGGG + Intronic
1096685086 12:53282973-53282995 CTTCCCTCTGAGATCCCCTGGGG - Intronic
1096779026 12:53981750-53981772 CCAGCCCTTGGGCTGCCCTGTGG + Intergenic
1097178304 12:57156355-57156377 CCCCTCTCTGGGCCCTCCTGTGG + Intronic
1101834367 12:108284981-108285003 CCAGGGTCTGGGCTCCCCTGAGG - Intergenic
1102220468 12:111191009-111191031 CCACCCCCTGGCATCCCTTGAGG + Intronic
1102309800 12:111835936-111835958 CCACTCCCTGGGCTCCTGTGTGG + Intergenic
1103209121 12:119154095-119154117 CCTCCCTCCGGTCTCCCTTGCGG + Intronic
1103210868 12:119165420-119165442 CCACCGCCTGGGCAGCCCTGGGG + Intergenic
1103480359 12:121246664-121246686 CCACCCTGCCGCCTCCCCTGTGG + Intronic
1103740343 12:123086891-123086913 CCATTCTGTGGGCTTCCCTGAGG - Intronic
1104292062 12:127479348-127479370 CCAGCCTCTTGGCTCCCTGGGGG + Intergenic
1104814678 12:131638861-131638883 CCAGCCCCTGGGCTCACGTGGGG + Intergenic
1104981063 12:132573326-132573348 CGCACCCCTGGGCTCCCCTGGGG + Intronic
1105037793 12:132939037-132939059 CCACTCCATGGGCTCCCATGCGG + Intronic
1106072333 13:26424580-26424602 CCACACTCTGGGAGCTCCTGGGG + Intergenic
1107467926 13:40666236-40666258 TCCCCCTCTTGGCTCTCCTGCGG - Exonic
1109359827 13:61281514-61281536 CCAACCTTTTGGCTTCCCTGGGG - Intergenic
1112396201 13:99034569-99034591 CCATCCTCATGGCACCCCTGAGG - Intronic
1113617363 13:111690231-111690253 CCTGCCTCTGGGCTAGCCTGTGG - Intergenic
1113622892 13:111775501-111775523 CCTGCCTCTGGGCTAGCCTGTGG - Intergenic
1113904892 13:113814710-113814732 CCCCTCTCTGGGCTCCGCTGGGG + Exonic
1114666906 14:24383237-24383259 TCACCCTCTGGGCTCTCCACAGG + Intergenic
1115306918 14:31943358-31943380 CCACCCTCACAGCTCCCCAGAGG + Intergenic
1117736472 14:58773545-58773567 CAACACACTGGGCTCTCCTGAGG - Intergenic
1118315196 14:64721787-64721809 GCACCCTAGGGGCTCTCCTGGGG - Intronic
1118763742 14:68896288-68896310 CCACCCAGTGGGCTTCTCTGTGG - Intronic
1118815695 14:69312391-69312413 ACACCCTCTGGGCTAACATGGGG - Intronic
1119554236 14:75541241-75541263 CCACACACTGGGGTCCCCTGGGG - Intronic
1121020724 14:90578593-90578615 CCACCCTCAGGGCCCACCCGGGG + Intronic
1121092639 14:91193406-91193428 CTACCCTCTGAGCTCCCATGAGG - Intronic
1121553691 14:94820620-94820642 CCACCCTGTGGCTTGCCCTGGGG - Intergenic
1122093254 14:99353609-99353631 CCATCCATTGGGCTACCCTGGGG - Intergenic
1122218804 14:100222254-100222276 CCACCCCTGGGGCTCCCCTGTGG - Intergenic
1122435024 14:101689365-101689387 CACCCCTGTGGGCTCCCCAGCGG + Intergenic
1122600194 14:102917560-102917582 CAGCACTCTGGACTCCCCTGAGG + Intergenic
1122853249 14:104547937-104547959 CCAGCCTCTGGCCACACCTGGGG - Intronic
1123789975 15:23710591-23710613 GCCCCCTCTGCACTCCCCTGTGG + Intergenic
1124006727 15:25800729-25800751 CCCCACTCTGGGGGCCCCTGAGG + Intronic
1124239764 15:28019657-28019679 CGGCCCTCTGGCCTGCCCTGTGG - Intronic
1124632446 15:31345347-31345369 CCACCCTGTGTGCTGCTCTGGGG + Intronic
1124920753 15:34023929-34023951 CCACTCTCTGGGCTCCTCTCTGG - Intronic
1125519656 15:40340719-40340741 CCACCCTCTGGGGGCAGCTGGGG - Intronic
1126103237 15:45132072-45132094 GCATCCTCTGGGCTCCCCCAAGG + Intronic
1127999561 15:64178154-64178176 CCACCCTCTGGGCTCTCAACTGG - Intronic
1129256375 15:74336288-74336310 CCACCCTCCTGGGTCCACTGTGG - Intronic
1129267469 15:74401669-74401691 CCTCCCTCTGGGGCCTCCTGTGG + Intergenic
1130071573 15:80650837-80650859 TCAGTCTCTGGCCTCCCCTGAGG + Intergenic
1131070143 15:89460945-89460967 CCACCCCCTTGGCCCCCCAGCGG + Intergenic
1131092497 15:89633101-89633123 CCGCACCCAGGGCTCCCCTGGGG - Intronic
1131344222 15:91631134-91631156 CCACCCTCTGGGCTGGCCCTGGG - Intergenic
1132010165 15:98268179-98268201 CCAGCCTCTGTGCAACCCTGGGG - Intergenic
1132285603 15:100660069-100660091 CCACCATCTGGGCTCCCACGCGG - Intergenic
1132292345 15:100712486-100712508 CCACATTCTGGTCTCCCCTGAGG + Intergenic
1132483530 16:178158-178180 GCACCCACTCAGCTCCCCTGAGG + Intergenic
1132546492 16:535653-535675 CCCGCCTCTGGGCTCCCTGGAGG - Intronic
1132554914 16:568149-568171 CCAACCCCTGGGCTCCCTGGGGG + Exonic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1132649092 16:1012510-1012532 CCATCTCCAGGGCTCCCCTGAGG + Intergenic
1132699883 16:1217818-1217840 CCTGCCTCTGGGCTCCCCAAGGG + Intronic
1136299078 16:29321158-29321180 CCACGCTCTGGCTGCCCCTGAGG - Intergenic
1136513415 16:30753317-30753339 CCACCCCCTGCTCACCCCTGGGG - Intronic
1137597332 16:49733682-49733704 TCATCCTCTGGGCTCCCAAGGGG + Intronic
1138289744 16:55836704-55836726 ACACCCTCTGGTTTCCCATGTGG + Intergenic
1139023320 16:62780311-62780333 CCACCCCCTGGGGCCCCCTCAGG + Intergenic
1139491781 16:67289824-67289846 CCACCCTGTGAGATGCCCTGGGG - Intronic
1140926638 16:79590056-79590078 CCACCCTCTGAGGTCCCCCGAGG - Intronic
1141431125 16:83970591-83970613 CCACCCTCTGTCCTCGCCTTGGG - Intronic
1141703561 16:85653156-85653178 CCCCCATCTGGGCCGCCCTGAGG + Intronic
1141850937 16:86645572-86645594 CCACCCTCGGGGCTGCCCACAGG - Intergenic
1142133447 16:88441256-88441278 CCACCCTCGGGCCTCCCCCCAGG + Intergenic
1142249139 16:88983178-88983200 TCGCCCTCAGGACTCCCCTGGGG + Intergenic
1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG + Intronic
1142962129 17:3557613-3557635 CCACGCTCTGGGCTCCCCAGGGG + Intronic
1142975125 17:3638887-3638909 CTACTCTCTGGCCTCCTCTGGGG - Intronic
1143094933 17:4473756-4473778 CCACCCTGCAAGCTCCCCTGTGG - Intronic
1143239706 17:5433629-5433651 CTAGCCTCTTGGCACCCCTGGGG - Intronic
1143379854 17:6489237-6489259 CCAACCTCTGGGGTCCACAGGGG + Intronic
1143539664 17:7561659-7561681 CCGCCCTCCTGGCTCTCCTGTGG + Intergenic
1143871343 17:9959169-9959191 CCACCCTGAGGGCGCCCCTCGGG + Intronic
1144744752 17:17606668-17606690 CCACCCGCTGGACTCCTCTGAGG + Intergenic
1145009958 17:19362425-19362447 CAACCCCCCGGGCTGCCCTGTGG - Intronic
1145094874 17:20016709-20016731 CCACCTCCTGGGCTCCTGTGCGG + Intronic
1145791875 17:27632494-27632516 CCACCCTGTGGAGGCCCCTGAGG + Intronic
1146322611 17:31858830-31858852 CCGCCCGCTGGGCGCCGCTGCGG - Intronic
1146703304 17:34980781-34980803 CCTCCCCCTGGGCTCCCGGGAGG - Intronic
1147458567 17:40554034-40554056 CCACACTCTGGGCTCCAGAGTGG - Exonic
1147604637 17:41767570-41767592 CCACCCCCCCAGCTCCCCTGTGG - Exonic
1148332499 17:46820758-46820780 CCACCCACAGGGCTCCCAGGTGG + Intronic
1148346843 17:46908860-46908882 CCTCCATTTGGGCTCCTCTGAGG - Intergenic
1148484875 17:47984240-47984262 CCACCCCCTGTGCCCCTCTGAGG + Intergenic
1150388626 17:64778706-64778728 CCCGCCTCGGGGCTCCGCTGGGG + Intergenic
1152066915 17:78117215-78117237 CCACCCTCTCAGGTCACCTGAGG - Intronic
1152072081 17:78138885-78138907 CCACCCTCTGGGCTGCCATGGGG + Intronic
1152190523 17:78884934-78884956 CCACCCTGAGAGCTGCCCTGGGG - Intronic
1152286467 17:79415883-79415905 CCAGTGTGTGGGCTCCCCTGGGG - Intronic
1152606296 17:81292612-81292634 CCTCCCTCTGGGCAGCCCTCAGG + Intronic
1152638698 17:81440648-81440670 CCACACTCCCGGCTGCCCTGGGG - Intronic
1152643085 17:81457269-81457291 TCACCCTCTGGGCCGCTCTGTGG - Intronic
1152644169 17:81461191-81461213 GCAGCTTGTGGGCTCCCCTGGGG - Exonic
1152891074 17:82882020-82882042 CCAACCTTTGGCCTCTCCTGGGG + Intronic
1155238784 18:23846403-23846425 CCACCCTCAGGGCTGCAGTGAGG - Exonic
1158648303 18:59266259-59266281 CCACCCTCAGAGCTGCCCTGCGG + Intergenic
1160011716 18:75111183-75111205 ACACCCTCAGGGGACCCCTGGGG - Intergenic
1160514105 18:79469068-79469090 TCACGCTCTGGACCCCCCTGGGG + Intronic
1160753433 19:746322-746344 CCACCCCCTGAGCTCCTCCGAGG + Exonic
1160791269 19:924880-924902 CCGCCCTCCAGGCTCCCCTGGGG + Intergenic
1160878486 19:1308854-1308876 CCCCCACCTGGCCTCCCCTGGGG + Intergenic
1160966017 19:1747277-1747299 CCACCTTCCGGGCTCGCCAGGGG - Intergenic
1161272470 19:3397650-3397672 CCACCCAGTGGGCTGCCCGGAGG + Intronic
1161273913 19:3404886-3404908 CCCGCCTCTGGGGACCCCTGGGG - Intronic
1161408075 19:4101556-4101578 CCACCATCTCAGCTTCCCTGGGG - Intronic
1161560279 19:4969225-4969247 CCTCCCCGTGGGCTCACCTGAGG - Exonic
1161717852 19:5886851-5886873 CCTCCCTCTGTGCTCTGCTGGGG + Intronic
1162327144 19:10006135-10006157 TCACCCTCTGGAGTCCTCTGGGG + Exonic
1162342976 19:10102893-10102915 CCACGCTCTGGGCTCTGCAGTGG - Intergenic
1162569866 19:11465651-11465673 CCCCTCTCTGGGTTCGCCTGGGG - Intronic
1162947877 19:14054641-14054663 TCACCCTCAGGGCTGCCCTGGGG + Exonic
1164143993 19:22499065-22499087 CCACTCTGTGGGCTCCTGTGCGG - Intronic
1164474448 19:28564364-28564386 CCACACTCTGTGATCACCTGTGG + Intergenic
1164596439 19:29533466-29533488 CCACCTTCTGGGCACCCCAAAGG - Intronic
1164720486 19:30428498-30428520 CTACTCTCTGGGCTCCTATGAGG - Intronic
1165320777 19:35083930-35083952 CCCTCCTCTGTGCTCCCCTGTGG - Intergenic
1166216062 19:41335890-41335912 GAGGCCTCTGGGCTCCCCTGGGG - Intronic
1166295339 19:41886689-41886711 CCACCCTGTGGGTCCACCTGGGG - Intronic
1167466789 19:49654425-49654447 CAACCAGGTGGGCTCCCCTGGGG + Exonic
1167539167 19:50074378-50074400 CCTCCCTCTGCCCTCCCCCGGGG - Intergenic
1167649845 19:50723296-50723318 CGCCCCTCTTGGCTCCCCGGAGG - Intergenic
1168009447 19:53518922-53518944 CCACCATCTGTCCTCCCCAGAGG - Intergenic
925088656 2:1134801-1134823 CCACTCTGTGGGCTCCTGTGCGG - Intronic
926188883 2:10712480-10712502 CCACCTTGTGTACTCCCCTGAGG - Intergenic
926762130 2:16287460-16287482 CCACCCTCTGGGCTTCCAGCAGG - Intergenic
927683934 2:25158108-25158130 CAGACCTCTGGGCTCCTCTGGGG + Exonic
927743101 2:25590171-25590193 CCTACATCTGGGCTCCCCAGAGG + Intronic
928128131 2:28630105-28630127 CCTCCCTCAGGGCTCCAGTGTGG - Intronic
928684010 2:33729088-33729110 CAGCCCTCTGGGCTGCTCTGTGG + Intergenic
931557155 2:63518537-63518559 AAACCCTCTGGGCTCCCCACTGG - Intronic
932462404 2:71891437-71891459 CCACCCCCAGGGCTTCTCTGCGG - Intergenic
934657411 2:96123422-96123444 CCAGCCACAGGGCTGCCCTGAGG + Intergenic
936528320 2:113257508-113257530 CCACCCTCTGGGCTGATCTAAGG - Intronic
936608422 2:113979350-113979372 CCCCCATCCGGGCTCCCCGGGGG - Intergenic
938213126 2:129485302-129485324 CCACTCTCTGGACTACCCAGAGG - Intergenic
938540412 2:132280243-132280265 GCACCCACTGGGCTCCCCATGGG + Intergenic
940099751 2:150021171-150021193 ACACCCTCTGTGCTTCCCTCGGG + Intergenic
945992249 2:216405844-216405866 CCTCCTTCAGGTCTCCCCTGGGG + Intergenic
946188000 2:217992102-217992124 CCACCTTTTGGGCCCCACTGCGG + Intronic
948424594 2:237878946-237878968 CAACCCTCTGGGGTCTCCAGGGG + Intronic
948643276 2:239388594-239388616 CCACCCTCTGGGCCCCCCTTTGG + Intronic
948912335 2:241010907-241010929 CCACCGTCTGGTCTCCTTTGGGG - Intronic
1168976743 20:1971943-1971965 CCTCCCTCTGGGGTCCCAGGTGG - Intergenic
1169088414 20:2841161-2841183 CCCCCCTCGGAGCGCCCCTGTGG - Intronic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1172511319 20:35503112-35503134 CCACTCTCTGGGTTTCCCTCTGG - Exonic
1173345860 20:42199339-42199361 TCTCCCTCTGGGCTCCACTCTGG + Exonic
1175251943 20:57615215-57615237 CCACCCTCAGGGCACCTCTGCGG - Intronic
1175282476 20:57813313-57813335 CCAGCCTCTGCGCCCCTCTGAGG + Intergenic
1175871748 20:62212570-62212592 CCAGCCGTTGGCCTCCCCTGTGG - Intergenic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1176235486 20:64051691-64051713 CCACCCTCTTGGCTGGGCTGTGG + Intronic
1176679298 21:9810881-9810903 ACACCCTCTGGCAACCCCTGAGG + Intergenic
1177693836 21:24546016-24546038 CTTCCCACTGGACTCCCCTGAGG + Intergenic
1178619082 21:34158597-34158619 CCACCCTCTGGCCATGCCTGGGG - Intergenic
1180054199 21:45348796-45348818 CCCTCCTCTGGGTTCTCCTGGGG + Intergenic
1180421121 22:12815664-12815686 CGGCCCCCTGGGATCCCCTGAGG + Intergenic
1180844880 22:18975542-18975564 CCACCCACTGGGCGCCCCGTGGG - Intergenic
1181056581 22:20263167-20263189 CCACCCACTGGGCGCCCCGTGGG + Intronic
1181363530 22:22357031-22357053 CTTCCCTCTGGGATGCCCTGGGG - Intergenic
1181433098 22:22894781-22894803 CAAGCCTCAGGGCTCCTCTGAGG - Intronic
1181505890 22:23356784-23356806 ACACCCTCTGGTTTCCCATGTGG - Intergenic
1181521156 22:23449426-23449448 CCACTCCCTCGGCTCCCCTCCGG + Intergenic
1181600880 22:23951306-23951328 CCTCCCTCTGGCCTGCCCAGGGG - Intergenic
1181607633 22:23990020-23990042 CCTCCCTCTGGCCTGCCCAGGGG + Intergenic
1181636828 22:24178376-24178398 TCCTCCTCTGGGCTCCCATGTGG - Exonic
1181797446 22:25320349-25320371 CCACCCACGGGTGTCCCCTGGGG + Intergenic
1182132909 22:27871513-27871535 CCACCATCTGGGCTGCTCTCTGG + Intronic
1182374691 22:29838071-29838093 CCATCCTCTGGCCTCCATTGCGG - Intronic
1183522312 22:38302770-38302792 CCATCCTCTGGCATCCTCTGGGG + Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1184393201 22:44217594-44217616 CTTCCCTGTGGGCTCACCTGCGG + Intronic
1184509599 22:44925914-44925936 CCACAGTCTGGGCTGGCCTGGGG - Intronic
1184596467 22:45517101-45517123 CCGCCCTCTGGGCCACCCCGAGG + Intronic
1185106069 22:48870663-48870685 ACACACCCTGGGCCCCCCTGTGG + Intergenic
1185114181 22:48921935-48921957 CCTCCTTCGGGGCTCCCGTGAGG - Intergenic
1185188202 22:49415881-49415903 CCAAGCTCTGGGCGCACCTGGGG - Intronic
1185247222 22:49779628-49779650 CCACACGCTGAGCTGCCCTGGGG + Intronic
950011448 3:9727031-9727053 CCTCCCTTTGAGCTCCCCTTTGG - Intronic
950626189 3:14248833-14248855 CCAGGCTCTGAGCTCCTCTGGGG + Intergenic
950660371 3:14463512-14463534 CCGCCCTCTGGAGACCCCTGCGG + Intronic
950929432 3:16774000-16774022 CCACTCCATGGGCTCCCGTGTGG + Intergenic
952425935 3:33174447-33174469 CCCAGCTCTGGGCTGCCCTGAGG - Intronic
952903550 3:38125614-38125636 GCACCCACTGGGCTGCACTGGGG - Exonic
954335369 3:49913343-49913365 CCATCCTTTGAGCTCTCCTGTGG + Exonic
954715063 3:52522825-52522847 CCACCCTGTGGTTTTCCCTGTGG + Exonic
955917153 3:63917915-63917937 AAACCTTCTGGCCTCCCCTGGGG - Intronic
956371711 3:68570654-68570676 AAACCCTCTGGGCTCCACTCTGG - Intergenic
961199406 3:125032436-125032458 CATGCCTCTGGGCTCCTCTGGGG + Intronic
961502869 3:127350131-127350153 CTTCCCTGGGGGCTCCCCTGTGG - Intergenic
962283713 3:134070337-134070359 CCACTCCATGGGCTCCCCTGCGG - Intronic
962808828 3:138945472-138945494 ACACCCTCTGGGCCCGCCTCTGG - Exonic
963604724 3:147404723-147404745 CCACCTTCTTGGCTCTCCTCCGG - Intronic
964000238 3:151762310-151762332 CCACCCTACTGGCTCCCATGGGG + Intergenic
964339091 3:155689082-155689104 CCACCCTCCCAGCTCCCCAGTGG + Intronic
967937337 3:194739476-194739498 CCACCCTAGAGGCTCCACTGGGG + Intergenic
968595614 4:1480907-1480929 CCACCCTGTGGCCAGCCCTGGGG - Intergenic
968730456 4:2267103-2267125 CCACCCTCTGGACTCTGCAGTGG - Intergenic
968905370 4:3448349-3448371 CCAGGCTCTGGGCTCCCCAGGGG - Intronic
968930399 4:3575838-3575860 CCACCCACTGCTCTCCCCGGAGG + Intergenic
969377331 4:6771569-6771591 CCAAGCTATGGGCTCCTCTGGGG - Intergenic
969796620 4:9532457-9532479 CCAGCCTCGGGGCTTGCCTGTGG - Intergenic
971682778 4:29723021-29723043 CCCCTCTGTGTGCTCCCCTGTGG - Intergenic
973360619 4:49161389-49161411 CGGCCCCCTGGGATCCCCTGAGG - Intergenic
975689519 4:76950004-76950026 GCACCCGCCCGGCTCCCCTGTGG - Intronic
980283455 4:130752766-130752788 GCATCCTCTGGACTCTCCTGGGG - Intergenic
980436702 4:132785018-132785040 CCACCCTATCCGCTGCCCTGGGG - Intergenic
980879812 4:138698436-138698458 CCACCCACTGGCCTCATCTGGGG - Intergenic
984459566 4:180016453-180016475 TCACCTTCTTGGCTCCACTGTGG + Intergenic
984770204 4:183430697-183430719 CCAGGCCCTGAGCTCCCCTGAGG - Intergenic
987073638 5:14360475-14360497 CATACCTCTGGGCTGCCCTGTGG + Intronic
987386844 5:17338161-17338183 CCACCTTGTGAGCTGCCCTGTGG - Intergenic
989159357 5:38375513-38375535 CCACTCCCTGGGGTCCTCTGTGG + Intronic
989559719 5:42836653-42836675 CAGCCCTGTGGGCTCCCATGCGG + Intronic
993228833 5:85204955-85204977 ACACCCTCTGGGCTCCACACAGG + Intergenic
993770329 5:91917559-91917581 CCACTCCGTGGGCTCCCGTGCGG + Intergenic
994147492 5:96411187-96411209 CCAGTCTCTGGGCCCTCCTGGGG + Intronic
994251472 5:97541952-97541974 CCACCCCGTGGGCTCCTGTGCGG - Intergenic
994908322 5:105868832-105868854 CCACCCTCTGATCTCCATTGGGG - Intergenic
997200656 5:132008260-132008282 CCCCACTCTGGGCTCCCATTAGG - Intronic
997375266 5:133393293-133393315 CCACCCTCTGGGTTATCCTTTGG - Intronic
997454008 5:134004567-134004589 CCTCCCTCTCAGCTCCCCAGGGG + Intronic
997659626 5:135579297-135579319 CCACCGTCTGGGCTCCCCAAAGG - Intergenic
998149222 5:139747474-139747496 CCTCCCTCTGGGCTCGTCTCTGG + Intergenic
998506239 5:142674923-142674945 CCTCCCTCTGACCTCCCCTAGGG + Intronic
999197595 5:149793094-149793116 CCATCATCTGGGCCTCCCTGTGG + Intronic
999233446 5:150076644-150076666 CCACCTCCTCTGCTCCCCTGTGG + Intronic
999806604 5:155087158-155087180 CAGCCCTCTGGATTCCCCTGGGG - Intergenic
1000019904 5:157309969-157309991 GCACCCTCGCGGCTCCCCTCCGG - Intronic
1000028864 5:157384487-157384509 CCACCTTCTGTCCTCCGCTGAGG - Intronic
1000035869 5:157447473-157447495 CCACGCTCTGGATTCCTCTGGGG + Intronic
1000252204 5:159506394-159506416 CCACCCAGTGGCCTGCCCTGTGG + Intergenic
1001644168 5:173268082-173268104 CCTTCCTCTGGGCACCTCTGCGG + Intergenic
1002043707 5:176530884-176530906 CCACCCACATGGCGCCCCTGGGG - Exonic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002571189 5:180140211-180140233 CCCCTCTCTGGGCATCCCTGTGG - Intronic
1002586550 5:180252459-180252481 CCACTGTCTCTGCTCCCCTGAGG + Intronic
1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG + Intronic
1003133942 6:3418620-3418642 CCAGCCTCTGGGCTTCCCCCTGG + Intronic
1003266443 6:4568576-4568598 TCAACCTCTGGGCTGCCCTTTGG - Intergenic
1005832338 6:29680915-29680937 CCAACCTCTGGGGTCCTCCGGGG - Intronic
1005994458 6:30922910-30922932 CCACACTCAGGGATCCCGTGAGG - Exonic
1006153270 6:32000680-32000702 CCTTCCTCAGAGCTCCCCTGTGG - Intronic
1006159578 6:32033417-32033439 CCTTCCTCAGAGCTCCCCTGTGG - Intronic
1006193426 6:32223074-32223096 CCACCCTCAGGGCTGCTGTGTGG - Exonic
1006351055 6:33521585-33521607 CCACGCGATGGGCTCCCGTGAGG - Intergenic
1006671127 6:35730351-35730373 CCACCTTCTGCCCTCCTCTGTGG - Intergenic
1011014096 6:82735920-82735942 CTACCCTCAGGGCTCTTCTGTGG - Intergenic
1016859022 6:148698698-148698720 CCACTCTGTGGGCTCCTGTGCGG - Intergenic
1017011733 6:150068148-150068170 CCACCCTCAGGTCACACCTGAGG + Intronic
1017325127 6:153133907-153133929 CCCCTCCATGGGCTCCCCTGCGG + Intergenic
1018390688 6:163338835-163338857 CCACCCACTAAGATCCCCTGAGG + Intergenic
1019194129 6:170271464-170271486 TCTTCCACTGGGCTCCCCTGGGG + Intergenic
1019328340 7:450698-450720 CCACCCTGTGGGCTCCACACAGG - Intergenic
1019399971 7:847243-847265 CCAGTCTCCGGGGTCCCCTGGGG + Intronic
1019399998 7:847315-847337 CCAGGCTCCGGGATCCCCTGGGG + Intronic
1019400022 7:847387-847409 CCAGTCTCCGGGATCCCCTGGGG + Intronic
1019400050 7:847459-847481 CCAGTCTCCGGGGTCCCCTGGGG + Intronic
1019400081 7:847545-847567 CCAGTCTCCGGGGTCCCCTGGGG + Intronic
1019400111 7:847631-847653 CCAGTCTCCGGGGTCCCCTGGGG + Intronic
1019400142 7:847717-847739 CCAGTCTCCGGGGTCCCCTGGGG + Intronic
1019400173 7:847803-847825 CCAGTCTCCGGGGTCCCCTGGGG + Intronic
1019400215 7:847925-847947 CCAGTCTCCGGGATCCCCTGGGG + Intronic
1019400239 7:847997-848019 CCAGTCTCCGGGATCCCCTGGGG + Intronic
1019400250 7:848033-848055 CCAGTCTCCGGGATCCCCTGGGG + Intronic
1019412094 7:911191-911213 CCACCCTCTGGCCTCACCCCTGG - Intronic
1019415119 7:923570-923592 AGACCCTCTGCCCTCCCCTGCGG + Intronic
1019505589 7:1388928-1388950 CCACCCTCTTGCGTGCCCTGAGG - Intergenic
1019578843 7:1750273-1750295 CCAGCCTGTGAGCTCCCCGGGGG - Intergenic
1019590182 7:1827052-1827074 CCACTCCCTCGGCTCCCCTCCGG - Intronic
1020004435 7:4774836-4774858 ACACCCTCTGGGCTCATCTTAGG + Intronic
1020213463 7:6171841-6171863 CCACCCTCAGGCATCCCCTCTGG + Intronic
1021573940 7:22090711-22090733 ACCCCCTGTGGGCTCCCGTGCGG + Intergenic
1022965596 7:35468500-35468522 CCACCCTATGGCAGCCCCTGGGG - Intergenic
1023632035 7:42174734-42174756 TCACCCTCTGTGCGGCCCTGGGG - Intronic
1023840943 7:44097125-44097147 CCACCCACAGGCCACCCCTGAGG - Intergenic
1023921527 7:44633783-44633805 CCACAGTCTGGGGTCACCTGTGG - Intronic
1026742936 7:72990327-72990349 CCACCTTCTGGGCTCCCAGTAGG - Intergenic
1026857064 7:73762100-73762122 CCAACACCTGGGCACCCCTGGGG - Intergenic
1027100799 7:75374751-75374773 CCACCTTCTGGGCTCCCAGTAGG + Intergenic
1027128072 7:75571375-75571397 CCACCCTCTCAGCTCCCTTCAGG + Intronic
1032402013 7:131630192-131630214 CCACCCACTCGGCTTTCCTGGGG - Intergenic
1034748321 7:153544145-153544167 TCACCCTCATGGCACCCCTGAGG - Intergenic
1037331599 8:17748609-17748631 CCACCACCTGGGCACCACTGTGG + Intronic
1037578489 8:20230463-20230485 CCACCCTCAGGGCAGCTCTGTGG - Intergenic
1038535250 8:28349002-28349024 CCGCCATCTGGGCTCCTCTCTGG + Intronic
1039850601 8:41361573-41361595 CCACTCTCTGCCATCCCCTGGGG - Intergenic
1039903077 8:41767007-41767029 CCCCCCTCGGGGCACCCCGGCGG + Intronic
1040318419 8:46276966-46276988 CAACCCTGTGGGCTCCTCTGGGG + Intergenic
1040439623 8:47427721-47427743 CCACTCTGTGGGCTGCACTGTGG - Intronic
1044533748 8:93337056-93337078 CCAGCCCCTGGTCTCCACTGGGG + Intergenic
1044926507 8:97213744-97213766 CCATCCTCTAGGTTCCTCTGAGG + Intergenic
1045222830 8:100215183-100215205 CCATCCTCTGGTGTCCTCTGAGG + Intronic
1049156872 8:141072748-141072770 CTCCCCTCTGGACCCCCCTGTGG - Intergenic
1049368576 8:142252793-142252815 CCCCCATCCTGGCTCCCCTGTGG + Intronic
1049404806 8:142447591-142447613 CCACCCTCCGGGCTCCAAGGAGG + Intergenic
1049748010 8:144271110-144271132 CCAGCATCAGGGCTCTCCTGGGG + Intronic
1049790840 8:144472128-144472150 CCATCCTCAGGGCCCTCCTGAGG + Exonic
1050989913 9:12137549-12137571 CCAACATCTTGGCTCTCCTGAGG + Intergenic
1051493682 9:17695580-17695602 ACTCCCTCTGTGCTCGCCTGGGG + Intronic
1053428462 9:38026457-38026479 CCAGCCTTTTAGCTCCCCTGTGG - Intronic
1053475975 9:38382258-38382280 CCACCCTCTGGTGGCCCCTGAGG - Intergenic
1055739197 9:79367427-79367449 CCACCTGCTGAGCTCTCCTGTGG - Intergenic
1056852145 9:90093773-90093795 CCTCGCTCTGGGGCCCCCTGTGG + Intergenic
1056934867 9:90908785-90908807 CCACCCTCTGCACGCCCCAGAGG - Intergenic
1057490297 9:95515639-95515661 CCCGCCCCCGGGCTCCCCTGAGG + Intronic
1057549224 9:96039792-96039814 CCATCCTCTGTGCAGCCCTGGGG - Intergenic
1057725243 9:97563854-97563876 CCAGCCTCCTGGCTCCCTTGCGG + Intronic
1057911086 9:99021194-99021216 CCTCCCTCTGGGCTGCACAGAGG + Intronic
1058942198 9:109823562-109823584 CCACTCTGTGGTCTCCACTGTGG - Intronic
1059440866 9:114306116-114306138 GCCCCCACTGGGCTCCCCTAGGG - Intronic
1060103929 9:120862053-120862075 CCTCCCTCTGGGCCACCCTAGGG - Intronic
1060104161 9:120863132-120863154 ACACCGGCTGGGCTCCTCTGAGG + Intronic
1060719781 9:125969170-125969192 CCAGCCTCTGGTGTCCCCTGGGG + Intergenic
1060748930 9:126156118-126156140 TCACCCGATGGGCTGCCCTGGGG - Intergenic
1061177873 9:129008419-129008441 CCACCCTCCAGGCTCCACTAAGG - Exonic
1061386838 9:130295482-130295504 CCACCCTCAGGGATCCCCAGGGG - Intronic
1061512345 9:131068917-131068939 TCACCCACTGGGCTCCCAGGAGG + Exonic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1061782708 9:133005180-133005202 CCACCCGCAGGGCTGTCCTGGGG + Intergenic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062253174 9:135608498-135608520 CACTCCTCTGGGCTCCCCTCAGG + Intergenic
1062289660 9:135788865-135788887 GCAGGCTCTGAGCTCCCCTGAGG - Intronic
1062315651 9:135965776-135965798 CCACTCTCTGGGACTCCCTGGGG + Intergenic
1062522203 9:136962759-136962781 CCACCCCAGGGGCTCTCCTGAGG + Intergenic
1203555974 Un_KI270743v1:208187-208209 CGGCCCCCTGGGATCCCCTGAGG + Intergenic
1203664469 Un_KI270754v1:13417-13439 ACACCCTCTGGCAACCCCTGAGG + Intergenic
1185886793 X:3790254-3790276 CTATCCTCTGAGCTCCTCTGAGG - Intergenic
1186749507 X:12607007-12607029 CCACCCATTGGGGTCCACTGTGG + Intronic
1187644103 X:21328199-21328221 AAACCCTCTGGGCTCCACTCTGG - Intergenic
1188009180 X:25039553-25039575 CCACCAAATGGGCTCCCCAGGGG - Intergenic
1189363621 X:40371544-40371566 ACACCCTCCAGGCTCACCTGAGG - Intergenic
1192227463 X:69238935-69238957 CCACCATCTGGAAACCCCTGTGG + Intergenic
1192561500 X:72130976-72130998 CCACCCGCTCGGCGCCCCCGGGG + Exonic
1195125295 X:101802963-101802985 TCACCCACAGGGCTCCCCTGGGG + Intergenic
1195351951 X:104004739-104004761 CCTCCCTCTGGGCTCCCGACAGG + Intergenic
1196371724 X:114986569-114986591 CCACCATCAGGGCTCTCCTAAGG + Intergenic
1197790359 X:130248464-130248486 AAACCCTCTGGGCTCCACTCTGG - Intronic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic
1200301805 X:154983936-154983958 CCACCTTCTTGGGTTCCCTGGGG - Intronic