ID: 1062119785

View in Genome Browser
Species Human (GRCh38)
Location 9:134828058-134828080
Sequence ACGTGAGCCCCAGTCAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062119784_1062119785 -9 Left 1062119784 9:134828044-134828066 CCTCATGGCGCACAACGTGAGCC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1062119785 9:134828058-134828080 ACGTGAGCCCCAGTCAGTCCAGG No data
1062119782_1062119785 12 Left 1062119782 9:134828023-134828045 CCAGGGATCAGTCTTCTGTGTCC 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1062119785 9:134828058-134828080 ACGTGAGCCCCAGTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062119785 Original CRISPR ACGTGAGCCCCAGTCAGTCC AGG Intronic
No off target data available for this crispr