ID: 1062120228

View in Genome Browser
Species Human (GRCh38)
Location 9:134830138-134830160
Sequence TACTGACTATACCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062120228_1062120235 -6 Left 1062120228 9:134830138-134830160 CCTTCCACCTGGTATAGTCAGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1062120235 9:134830155-134830177 TCAGTACAAGCGGGGGTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1062120228_1062120237 10 Left 1062120228 9:134830138-134830160 CCTTCCACCTGGTATAGTCAGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1062120237 9:134830171-134830193 TCCCTGGTAAGTGGCCACCTCGG 0: 1
1: 0
2: 0
3: 15
4: 141
1062120228_1062120236 1 Left 1062120228 9:134830138-134830160 CCTTCCACCTGGTATAGTCAGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1062120236 9:134830162-134830184 AAGCGGGGGTCCCTGGTAAGTGG 0: 1
1: 0
2: 0
3: 11
4: 116
1062120228_1062120242 24 Left 1062120228 9:134830138-134830160 CCTTCCACCTGGTATAGTCAGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1062120242 9:134830185-134830207 CCACCTCGGCCCGGCCACCTCGG 0: 1
1: 0
2: 0
3: 19
4: 316
1062120228_1062120240 15 Left 1062120228 9:134830138-134830160 CCTTCCACCTGGTATAGTCAGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1062120240 9:134830176-134830198 GGTAAGTGGCCACCTCGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062120228 Original CRISPR TACTGACTATACCAGGTGGA AGG (reversed) Intronic
900531612 1:3156544-3156566 TCCTGCCTCTACCAGGAGGAGGG - Intronic
907990429 1:59577135-59577157 TACTGACTGTACCAGGTGCTGGG - Intronic
910924952 1:92388629-92388651 GAGTGACTATACCTGGAGGAGGG + Exonic
912343004 1:108936049-108936071 TACTAACTATAAAAGCTGGAAGG + Intronic
918627042 1:186668105-186668127 TACTGCCTATATAAGGTGTAAGG + Intergenic
919924882 1:202187057-202187079 TACTGGCTCTGCCAGGGGGAAGG - Intergenic
920940422 1:210477074-210477096 TACTGACTTTACCAGGGGATGGG + Intronic
1070584958 10:77757226-77757248 TACAGACTATACAAGAAGGACGG - Intergenic
1071009693 10:80923598-80923620 TATTTACAAAACCAGGTGGAAGG + Intergenic
1072250689 10:93580094-93580116 GACAAGCTATACCAGGTGGATGG + Intronic
1075104228 10:119527153-119527175 TACTGTCTATCCCAGCTTGAGGG - Intronic
1082890310 11:58132057-58132079 TTCTGACTATCCCAGGAGGTGGG + Intronic
1084150125 11:67284194-67284216 CAGTAACTTTACCAGGTGGATGG - Exonic
1084282539 11:68107785-68107807 TTCTGACCATGCCTGGTGGAAGG - Intronic
1086304929 11:85469627-85469649 CACTGACCACACCAGGTGAAAGG - Intronic
1088094652 11:106084776-106084798 TACTAAAAATACCAGGTGGCGGG - Intronic
1088308592 11:108436373-108436395 TACTTTAAATACCAGGTGGAAGG - Intronic
1090220378 11:125016781-125016803 CACTGACTATGCCATGTGGTAGG - Intronic
1093308212 12:17544906-17544928 TCCAGGCTATACCATGTGGAAGG - Intergenic
1098257996 12:68637254-68637276 TACTGACTGTACCGAGTTGATGG - Intronic
1101014568 12:100486379-100486401 TAATTACTATACAAGGAGGAGGG + Intronic
1102039783 12:109793520-109793542 TACTCACTAGAGCAGCTGGAAGG + Exonic
1104625420 12:130349690-130349712 TACAGACTATGCCAGATGGATGG - Intronic
1124070531 15:26388663-26388685 TACTGATCACACCAGGTGGCTGG + Intergenic
1125767260 15:42144078-42144100 GACTGCCTGTACCTGGTGGACGG - Exonic
1128234205 15:66056421-66056443 TACCTACTATATCAGGTGCAGGG - Intronic
1128795355 15:70462701-70462723 CACTGAATATCCCAGGTGGGAGG + Intergenic
1131622267 15:94080679-94080701 TTCTGACTAGCCCAGGAGGAGGG - Intergenic
1133085892 16:3363163-3363185 AAATGACTATAACAGGTGGCAGG + Intergenic
1134600208 16:15527896-15527918 AACTGAATATATGAGGTGGAGGG - Intronic
1144536847 17:16097991-16098013 TACTTACTATACCAAATGTATGG - Intronic
1146031382 17:29369058-29369080 AACTGCCTATACAAGGTGGCAGG - Intergenic
1149613233 17:57974077-57974099 TTCTCCCTATACAAGGTGGATGG - Exonic
1150630548 17:66877426-66877448 TACTGGCTGTACCTGGAGGAGGG + Exonic
1152095616 17:78270018-78270040 TGCTGCCTCTGCCAGGTGGAGGG + Intergenic
1159500647 18:69264820-69264842 TACAGAATATACCTGGTTGATGG + Intergenic
1162567222 19:11451088-11451110 TCCTGAAGATACCAGGTGGATGG + Intergenic
928645283 2:33345722-33345744 AACTGGGTATACCAGGTGAAAGG + Intronic
929174472 2:38962297-38962319 TACAGACTATACTAGTTAGAAGG - Intronic
929632378 2:43477161-43477183 TACTGATTAAAGCAGGTGAAAGG - Intronic
932281715 2:70498597-70498619 TACTGACTGTAAAAGGTGGCAGG + Intronic
939131118 2:138237127-138237149 TACTTACTCTAACAGGAGGAGGG - Intergenic
941110108 2:161412351-161412373 TACTGATTATACCATTTGTATGG + Intergenic
945072562 2:206005964-206005986 TCCTGACTCTCCCAGCTGGAGGG + Intronic
1169060785 20:2659124-2659146 TAGAGACAAGACCAGGTGGAAGG + Intronic
1170065513 20:12305887-12305909 TTCTGACTAAACTATGTGGAGGG - Intergenic
1174681348 20:52411758-52411780 TACTGACAAAAACAGGTGGCTGG - Intergenic
1179987464 21:44929667-44929689 TATTGACAAAAACAGGTGGAGGG + Intronic
1181121154 22:20669313-20669335 TCCTGACTGTAGCAGGTGGTAGG - Intergenic
1182001489 22:26923537-26923559 TACTGACAAGACCAGGAGAAGGG - Intergenic
1182767550 22:32769281-32769303 TGATGACCATAGCAGGTGGAGGG - Intronic
1185157139 22:49200119-49200141 TACTGAATAAATCAGGAGGAAGG - Intergenic
955028284 3:55191219-55191241 TAATGACTATATCAGGGCGATGG - Intergenic
958729870 3:97950099-97950121 TAATGTCTATACCCGGTGGCTGG - Intronic
964531866 3:157677054-157677076 TACTGACAAAAGCAGGAGGAAGG + Intronic
967754593 3:193155052-193155074 TTCTCCCTATACAAGGTGGATGG - Intergenic
968814760 4:2816201-2816223 TACTAAAAATACCAGGTGGCAGG - Intronic
977354108 4:95924089-95924111 TAGTGACTCTAGCAGGAGGAAGG + Intergenic
987768461 5:22267685-22267707 TAGTGACTATAACAGATAGACGG + Intronic
988920071 5:35932967-35932989 TATTTACAAAACCAGGTGGAGGG - Intronic
991324995 5:65420850-65420872 TACTGACAATAATAGGAGGATGG + Intronic
996634867 5:125677439-125677461 TATTGTCTATCCCAGGTGAATGG - Intergenic
996817552 5:127590517-127590539 TACTTACTATATCTGGTGCACGG + Intergenic
997364539 5:133317514-133317536 CACTGACCATTCCAGGTTGAAGG + Intronic
997419575 5:133755387-133755409 TCCTGTCTATAGCAGGTGGAGGG - Intergenic
999779010 5:154834261-154834283 CACTGACTGTACCAGGTACAGGG + Intronic
1002415332 5:179117499-179117521 TATTTACAAAACCAGGTGGAGGG - Intronic
1005201750 6:23353407-23353429 TACTGACTATATTATGTGCAAGG - Intergenic
1006312242 6:33268967-33268989 TAATGTCCATAGCAGGTGGATGG - Intronic
1008891022 6:56490758-56490780 TACAGGCTATAACAGTTGGATGG + Intronic
1014488498 6:122031877-122031899 TAGTGACAATACCAGATGCAGGG - Intergenic
1018347304 6:162913714-162913736 GATTGACTATACCAAGTGGTTGG - Intronic
1021646440 7:22794287-22794309 TGCTGTCTGTACCAGATGGAAGG - Intergenic
1024946648 7:54814618-54814640 TACTGACTCTAGCAGGAGGCAGG + Intergenic
1028950147 7:96625327-96625349 TGGTGACTATAACAGGTTGAGGG - Intronic
1030848349 7:114451426-114451448 TACTGTCTACTCCATGTGGATGG + Intronic
1033124263 7:138694043-138694065 GACTGATTATACCAAGTGCAAGG + Intronic
1039807090 8:41009540-41009562 TACTGCCAACATCAGGTGGATGG - Intergenic
1041492194 8:58445907-58445929 TACTGACTATTTCAGGTGTAAGG - Exonic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044854438 8:96460095-96460117 TACTGACAATACCAAGTGCTGGG - Intergenic
1045034285 8:98165334-98165356 CACTGTATACACCAGGTGGAGGG + Intergenic
1045342806 8:101269459-101269481 TACTGACTTTACAGGGTGGGCGG - Intergenic
1046850437 8:118966109-118966131 TACTGAAAATACCATGTGGAGGG + Intergenic
1047310880 8:123690832-123690854 CACTGACTATAGCAGTTAGAGGG + Intronic
1053456052 9:38233855-38233877 TACTGACTACACAAAGTGGTTGG + Intergenic
1053475987 9:38382299-38382321 TACAGACTAAGCCAGGTGCAAGG - Intergenic
1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG + Intronic
1055334111 9:75214810-75214832 TTCTAACTATAACAGGTGAAGGG - Intergenic
1058379680 9:104363727-104363749 TACTGCCTATACCAGATGTAAGG - Intergenic
1058938359 9:109790314-109790336 TACTTACTATTCTAGGTGGGTGG + Intronic
1062120228 9:134830138-134830160 TACTGACTATACCAGGTGGAAGG - Intronic
1187330233 X:18331788-18331810 TGCTGACAATACCAGTTGGTTGG + Intronic
1187499872 X:19830983-19831005 TACTCAGTATACCAGGGGAATGG + Intronic
1197555996 X:127954547-127954569 TACTGAGTATATTAGGTGTATGG + Intergenic
1199591793 X:149474671-149474693 TGCTGACTATATCAGGTGATTGG - Intergenic
1201241363 Y:11959859-11959881 TACAGATTAAACCAGATGGAAGG - Intergenic