ID: 1062122185

View in Genome Browser
Species Human (GRCh38)
Location 9:134839711-134839733
Sequence TCTCTGGCTCCTCGCCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062122174_1062122185 15 Left 1062122174 9:134839673-134839695 CCAGGGAGCAGAGGCCGGAGGAG 0: 1
1: 0
2: 4
3: 70
4: 723
Right 1062122185 9:134839711-134839733 TCTCTGGCTCCTCGCCGGTGGGG No data
1062122179_1062122185 1 Left 1062122179 9:134839687-134839709 CCGGAGGAGAGGCAGGCAGGGTG 0: 1
1: 0
2: 8
3: 65
4: 601
Right 1062122185 9:134839711-134839733 TCTCTGGCTCCTCGCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062122185 Original CRISPR TCTCTGGCTCCTCGCCGGTG GGG Intronic
No off target data available for this crispr