ID: 1062122657

View in Genome Browser
Species Human (GRCh38)
Location 9:134842019-134842041
Sequence TACCCAGGGCTGCGCTTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062122657_1062122662 -2 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122662 9:134842040-134842062 TAGGAGACAGGACACCAGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 334
1062122657_1062122668 23 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122668 9:134842065-134842087 TTTGGAGCCAGACAGATTGTGGG 0: 1
1: 0
2: 2
3: 26
4: 198
1062122657_1062122671 26 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122671 9:134842068-134842090 GGAGCCAGACAGATTGTGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 291
1062122657_1062122669 24 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122669 9:134842066-134842088 TTGGAGCCAGACAGATTGTGGGG 0: 1
1: 0
2: 2
3: 25
4: 215
1062122657_1062122664 5 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122664 9:134842047-134842069 CAGGACACCAGCCTGGGTTTTGG 0: 1
1: 0
2: 0
3: 33
4: 364
1062122657_1062122667 22 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122667 9:134842064-134842086 TTTTGGAGCCAGACAGATTGTGG 0: 1
1: 0
2: 13
3: 71
4: 492
1062122657_1062122670 25 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122670 9:134842067-134842089 TGGAGCCAGACAGATTGTGGGGG 0: 1
1: 0
2: 0
3: 24
4: 250
1062122657_1062122663 -1 Left 1062122657 9:134842019-134842041 CCGGGCAAGCGCAGCCCTGGGTA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1062122663 9:134842041-134842063 AGGAGACAGGACACCAGCCTGGG 0: 1
1: 0
2: 3
3: 49
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062122657 Original CRISPR TACCCAGGGCTGCGCTTGCC CGG (reversed) Intronic
900202055 1:1412593-1412615 AAACCAGGCCTGCGCCTGCCTGG - Intergenic
900202764 1:1418722-1418744 AAACCAGGCCTGCGCCTGCCTGG - Exonic
901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG + Intronic
901874425 1:12158859-12158881 TACTCGGTGCTGCGCCTGCCCGG - Intergenic
902362718 1:15950885-15950907 TGGGCGGGGCTGCGCTTGCCAGG - Intronic
902721778 1:18308900-18308922 TGCCCTGGCCTGGGCTTGCCAGG - Intronic
903349840 1:22710967-22710989 GAGCCATGGCTGCGCTTCCCGGG - Exonic
904883948 1:33721703-33721725 TACCCAGGGCTAGGGTGGCCTGG - Intronic
905869523 1:41395141-41395163 ACCCCAGGGCTGCGCATGCCTGG + Intergenic
906477568 1:46180363-46180385 TGCCCAGGGCTGGTGTTGCCAGG + Intronic
908777458 1:67654548-67654570 TACCCAGGGATGGGATTGCTGGG + Intergenic
913719867 1:121581684-121581706 TACCCAGTGATGAGATTGCCAGG + Intergenic
914490377 1:148147474-148147496 TCCCCAGCCCTGTGCTTGCCTGG + Intronic
915740939 1:158117983-158118005 CACTCAGGGCTGCGCTGCCCCGG - Intergenic
916497841 1:165361107-165361129 TGCCTAGGGCTGTCCTTGCCAGG - Intergenic
918682153 1:187369180-187369202 TACCAAGGGCAAGGCTTGCCTGG - Intergenic
920572911 1:207031491-207031513 CACTCAGGGCTGCGTGTGCCAGG + Intronic
920674459 1:208029536-208029558 TTCCCAGGGCTGGCCTGGCCTGG + Intronic
921162053 1:212479847-212479869 TACCTAGGGCTATGCATGCCTGG - Intergenic
921390155 1:214607740-214607762 TCCCCAGCCCTGCGCTTGCCTGG - Intronic
921440587 1:215181870-215181892 TAGGCAGGGCTGGGCTTGGCAGG + Intronic
1063597913 10:7453821-7453843 TACCCAGGGGTGAGATTGCCAGG - Intergenic
1064167811 10:13001627-13001649 CGCCCAGGGCTGCCCTTCCCGGG - Exonic
1065360434 10:24884530-24884552 TATGCAGGGCTCCTCTTGCCTGG - Intronic
1067008904 10:42691418-42691440 TATCCAGGGCTGCACTGCCCGGG - Intergenic
1072617660 10:97060193-97060215 CACCCAGGGCTGGGCTGACCTGG - Intronic
1073069305 10:100783115-100783137 CACCCAGGGCTGCGCCTGGCTGG + Intronic
1076756923 10:132577438-132577460 TATCTCGGGCTGCGCATGCCCGG + Intronic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084121565 11:67071900-67071922 CTCCCAGGGCTGCACCTGCCAGG + Exonic
1085323067 11:75586657-75586679 TACCCAGGGCTCAGCCTGCTGGG + Intergenic
1085507522 11:77068708-77068730 CACCCAGGGCTAGGCTTGGCAGG + Intronic
1088783927 11:113163805-113163827 TGCCCAGTGCTGCGGGTGCCGGG + Intronic
1088959072 11:114642774-114642796 TACCCAGTACTGGGCTTGCTGGG + Intergenic
1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG + Intergenic
1090208012 11:124896460-124896482 TACCCAGGTCTGCCCAGGCCAGG + Intronic
1090404764 11:126469974-126469996 AACCCAGGCCTGCGACTGCCTGG + Intronic
1091093317 11:132793190-132793212 GACCCAGTGCTGCCCTTCCCGGG + Intronic
1097314614 12:58158921-58158943 TACTCAGGGATGCAATTGCCAGG + Intergenic
1104719119 12:131034857-131034879 AACACAGGGCCGCTCTTGCCTGG + Intronic
1105020716 12:132814892-132814914 AACCCAGGGCTCCACTTCCCAGG + Intronic
1105274236 13:18905583-18905605 TATCCAGGGATGCGCTACCCTGG + Intergenic
1105274238 13:18905586-18905608 TACCCAGGGTAGCGCATCCCTGG - Intergenic
1105972146 13:25439186-25439208 TACCCCGAACTGCCCTTGCCAGG - Intronic
1111642208 13:90982719-90982741 TACCCAGTGATGGGATTGCCAGG - Intergenic
1112389449 13:98969750-98969772 TAACCAGGGCAGTGCATGCCAGG + Intronic
1115652070 14:35409856-35409878 TGCGCAGGGCTGCTCCTGCCAGG + Intergenic
1118256907 14:64213261-64213283 TCCTCAGGGCTGGGCTTGTCTGG + Intronic
1121127717 14:91418321-91418343 TACCTGGGGCTGCACCTGCCAGG - Intergenic
1121707875 14:96012986-96013008 AAACCAGGCCTGGGCTTGCCTGG + Intergenic
1122306544 14:100770261-100770283 CACCCACGACTGGGCTTGCCAGG + Intergenic
1122857584 14:104567290-104567312 GAGCCAGGGCTGCCCTGGCCTGG + Intronic
1122954746 14:105065376-105065398 TACCCAGGGCCCCGCCTGCGTGG + Exonic
1124291589 15:28457033-28457055 TCCCCAGCCCTGCGCTTTCCTGG - Intergenic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1126701043 15:51367784-51367806 CACCCAGGGCTGCTCTGGGCTGG - Intronic
1127834950 15:62783408-62783430 CCCCCAGGGCTGCGCTGGCGAGG + Intronic
1128815781 15:70607087-70607109 CCCCCATGGCTGTGCTTGCCAGG - Intergenic
1131577488 15:93606302-93606324 TAGCCTGGGGTGAGCTTGCCAGG + Intergenic
1132719122 16:1307364-1307386 TCCCCACGGCTGCGCCTCCCAGG + Intergenic
1132733463 16:1374473-1374495 TTCCCCGGGGTGCGGTTGCCTGG - Intronic
1133981186 16:10634411-10634433 TGCCCAGGGCTGTGCTCACCGGG - Intronic
1134063551 16:11212927-11212949 TCCCCTGGGAGGCGCTTGCCAGG - Intergenic
1134068567 16:11246263-11246285 TGCCCAGGGCTGGGCATGCTGGG + Intergenic
1134441650 16:14302479-14302501 CACCCAGGGCTGCGCCTTCCCGG - Intergenic
1134521811 16:14922262-14922284 AACCCTGGGCTGCGGCTGCCTGG + Intronic
1134709481 16:16320913-16320935 AACCCTGGGCTGCGGCTGCCTGG + Intergenic
1134716694 16:16360942-16360964 AACCCTGGGCTGCGGCTGCCTGG + Intergenic
1134950122 16:18347732-18347754 AACCCTGGGCTGCGGCTGCCTGG - Intergenic
1134958056 16:18391217-18391239 AACCCTGGGCTGCGGCTGCCTGG - Intergenic
1136666720 16:31819354-31819376 TGCCCCGGGCTGCGCTTCCCCGG - Intergenic
1136707190 16:32200637-32200659 TCCCCAGCCCTGCGCTTGCCTGG + Intergenic
1136760720 16:32728780-32728802 TCCCCAGCCCTGCGCTTGCCTGG - Intergenic
1136807383 16:33141606-33141628 TCCCCAGCCCTGCGCTTGCCTGG + Intergenic
1137057434 16:35752370-35752392 TAAGCAGGGTTGGGCTTGCCAGG + Intergenic
1142201592 16:88763621-88763643 TACCCAGTGCTGCCCTGACCTGG - Intronic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1203062872 16_KI270728v1_random:989094-989116 TCCCCAGCCCTGCGCTTGCCTGG - Intergenic
1143319609 17:6059607-6059629 TGTCCAGGGCTGCGCTAGCTGGG + Intronic
1143502427 17:7347150-7347172 TGCCCAGTGCTGCGACTGCCGGG + Exonic
1143540803 17:7567624-7567646 TTCCCAGGTCTGCGCATGGCTGG - Intronic
1145190969 17:20842077-20842099 TCCCCAGCCCTGCGCTTGCCTGG + Intronic
1146428214 17:32763953-32763975 TTCCCAGGAGTGAGCTTGCCAGG - Intronic
1148484772 17:47983487-47983509 GACACAGAGCTGCTCTTGCCAGG - Intergenic
1150410080 17:64935235-64935257 TTCCCAGGGCTGTGCTCTCCTGG - Intergenic
1151347885 17:73514498-73514520 TTCCCAGGGCTGGGCTGGCTGGG - Intronic
1151671816 17:75575046-75575068 TCCCCTGGGCTGCCCTTCCCGGG + Exonic
1152226303 17:79094419-79094441 CACCCAGGGCTGGGCGGGCCTGG + Intronic
1152560529 17:81076447-81076469 TCCCCGGGGCTGTGCTTGCCAGG + Intronic
1153740402 18:8120089-8120111 TACGCAGGTCTGCTCTTGCTGGG + Intronic
1157168845 18:45383805-45383827 TGCCCTGGGCTCTGCTTGCCTGG + Intronic
1160921506 19:1523087-1523109 AACCCAGCGCTGCCCTTTCCTGG + Intergenic
1160959870 19:1715701-1715723 TACCCAGGGCTCAGCATCCCCGG + Intergenic
1160995233 19:1879346-1879368 TCCCCAGCCCTGCGCTTGCCTGG - Intronic
1167055713 19:47111016-47111038 CAGCCAGGGCTTCCCTTGCCAGG - Intronic
925147229 2:1589220-1589242 TGCCCAGGTCTGCGCAGGCCTGG - Intergenic
925271587 2:2613571-2613593 GCACCAGGGCTGCGCCTGCCTGG + Intergenic
925702832 2:6656121-6656143 TACCTGGGGCCGTGCTTGCCTGG - Intergenic
925760973 2:7184111-7184133 TACCCAGGGCTCAGCTTGTGAGG - Intergenic
926122999 2:10254974-10254996 TACCCTGGGGTGCCCTGGCCGGG + Intergenic
927212503 2:20647304-20647326 TACCCAGAGCTGAGCTGGCCTGG + Intronic
927497529 2:23560958-23560980 TCCCCAGGGCTGAGCTGGACTGG + Intronic
928404297 2:31002826-31002848 CACCCAGCCCTTCGCTTGCCTGG + Intronic
930156510 2:48112165-48112187 TGCCCAGGGCTGCGATAGTCCGG - Intergenic
935710165 2:105891382-105891404 TATCCAGGGCACCGCCTGCCTGG + Intronic
937933855 2:127226737-127226759 GAGCCTGGGCTGGGCTTGCCAGG - Intergenic
938964430 2:136375785-136375807 TATGCAGGGCTGGGCATGCCTGG - Intergenic
943829953 2:192448003-192448025 TACTCAGGGCTGCAGTTGTCTGG - Intergenic
947090381 2:226503647-226503669 TACCCAGTGCTGGGGTTGCTGGG - Intergenic
948256721 2:236573935-236573957 TACCCATGGCTGTGCCTTCCTGG + Intronic
948981557 2:241497296-241497318 TAACCAGGGCGGCACCTGCCCGG + Intronic
1170854858 20:20042552-20042574 AACCAAGAGCTGCACTTGCCAGG + Intronic
1171090934 20:22285324-22285346 TACCCATGGCTATGCTTTCCAGG - Intergenic
1174193130 20:48754472-48754494 AACCCATGGCTGCTGTTGCCTGG + Intronic
1179473763 21:41630417-41630439 AAGTCACGGCTGCGCTTGCCAGG - Intergenic
1180008743 21:45035509-45035531 TACCCAAGGCAGCTCTTCCCTGG + Intergenic
1180070157 21:45431890-45431912 AAACCAGGGCTGCCCTTGGCAGG - Intronic
1180208768 21:46280557-46280579 TAGCCAGGGCTGCAGATGCCTGG + Exonic
1181121306 22:20669886-20669908 TCCCCAGCCCTGCGCTTGCCTGG - Intergenic
1181334262 22:22116911-22116933 TCCCCAGCCCTGCGCTTGCCTGG - Intergenic
1182446888 22:30394957-30394979 TCCCCAGGCCTGCCCTTCCCAGG - Intronic
1182995646 22:34809560-34809582 TCCCCAGGCCTGCCCTTGGCAGG + Intergenic
1182995735 22:34810242-34810264 TCCCCAGGCCTGCCCTTGGCAGG + Intergenic
1183950099 22:41347948-41347970 GACCCAGGGCAGGGCTTGCAGGG + Intronic
1184267497 22:43357005-43357027 TCCCCACAGCTGCGCATGCCGGG + Intergenic
1184276766 22:43413094-43413116 TCCCCAGTGCTGGGCTGGCCTGG + Intronic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
950571563 3:13803376-13803398 AACCTAGGTCTGCCCTTGCCTGG + Intergenic
950683866 3:14602846-14602868 GACCCAGAGCTGAGCTGGCCCGG - Intergenic
952999295 3:38917294-38917316 TACCCAGTAATGGGCTTGCCAGG - Intronic
962033231 3:131623424-131623446 TACCCAGGTCTCCTCTTGCTGGG + Intronic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
966818859 3:183909492-183909514 GACCCAGGGCTTGGCTTGCCTGG - Intergenic
966831295 3:184011527-184011549 TGCCCAGGACTGCGCTTGCTGGG - Intronic
968489726 4:883550-883572 TGCCGGAGGCTGCGCTTGCCCGG - Intronic
974812473 4:66962575-66962597 TACCAAGGGCCGCTCTTGTCAGG + Intergenic
975612129 4:76213704-76213726 CACCCGGGGCCGCGCTCGCCAGG - Exonic
982091468 4:151883556-151883578 TCCTCAGGGCTGAGCTGGCCTGG + Intergenic
982126693 4:152189917-152189939 CACCAAGTGCTGTGCTTGCCGGG + Intergenic
984815279 4:183830573-183830595 TGCCCAGGGCTGGTCTGGCCTGG + Intergenic
985552630 5:541282-541304 GCCACAGGGCTGCGCTGGCCTGG + Intergenic
985665415 5:1179508-1179530 TTCCCAGGGCTGCTCCTGCAGGG + Intergenic
986081436 5:4398732-4398754 TACCCTTGGCTGTGCTTGGCAGG + Intergenic
998804011 5:145900769-145900791 TACCCAGTGATGGGATTGCCAGG - Intergenic
999410966 5:151349433-151349455 AACCCAGGGCTTCGGATGCCTGG - Intergenic
1000981756 5:167824059-167824081 TACGCAGGGCTGAGCTTTGCTGG - Intronic
1002706066 5:181161347-181161369 TGAGCAGGGCTGTGCTTGCCAGG - Intergenic
1006719886 6:36143224-36143246 GTCCCAGGGCAGGGCTTGCCTGG + Intronic
1008629228 6:53348156-53348178 TACCAAGGGCTGCCGTTGTCTGG + Intronic
1014057256 6:117030562-117030584 ACCCCAGGGCTGGGCTGGCCTGG - Intergenic
1015729799 6:136335833-136335855 TCCCCAGGGCCGCCTTTGCCTGG + Intergenic
1022644593 7:32218472-32218494 TACCCTGGGCTGCACGAGCCAGG - Intronic
1024628675 7:51230098-51230120 TTCTCAGGGCTGTGCTGGCCTGG - Intronic
1026977593 7:74507942-74507964 TATCCAGGGCTGACCTTCCCTGG - Intronic
1027135033 7:75617907-75617929 TACCCAAGGCTGCGCTTTCTAGG - Intronic
1032085976 7:128884164-128884186 AACCCAGAGCTGCCCTTGGCCGG + Intronic
1034584517 7:152077343-152077365 GACCCAGGGCCGCTTTTGCCCGG + Intronic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1035682084 8:1495520-1495542 GAGCCAGGACTGCGCTGGCCCGG + Intergenic
1037535293 8:19817735-19817757 GGCCCAGAGCTGCGCCTGCCTGG + Intronic
1039601056 8:38837799-38837821 TGCCCTGGGCTGGGCTTGCATGG - Intronic
1040312350 8:46243302-46243324 CCCCCAGGGCTGCGCTGGGCAGG + Intergenic
1045213072 8:100119187-100119209 TACCCAGGAATGCGATTGCTGGG - Intronic
1046366636 8:113240368-113240390 TACCCAGTGATGAGATTGCCAGG + Intronic
1048096765 8:131304202-131304224 TACCCAGGACTGGGGTTGCTGGG + Intergenic
1049175419 8:141189653-141189675 CACCCAGGGCTGGGGCTGCCTGG - Intronic
1049398338 8:142412293-142412315 TGCTCAGGGCCGCGCCTGCCGGG - Intergenic
1049415361 8:142492508-142492530 CACGCAGAGCTGTGCTTGCCAGG - Intronic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1049515558 8:143052998-143053020 AACACAGGGCTGCCCTCGCCTGG + Intronic
1053463338 9:38287663-38287685 TACCCAGAGATGAGCTGGCCTGG + Intergenic
1057642879 9:96844220-96844242 TACCTAGGAGTGAGCTTGCCAGG - Intronic
1060219702 9:121757934-121757956 TCCCCAGGGCTGGGGGTGCCAGG - Intronic
1060934332 9:127506771-127506793 TCCCCAGAGCTGAGCCTGCCTGG + Exonic
1061859433 9:133460399-133460421 TACCCCGGGCTGGGCTGGGCTGG + Intronic
1062028084 9:134349745-134349767 TCCCCAGGGCTGGGCCAGCCTGG + Intronic
1062122657 9:134842019-134842041 TACCCAGGGCTGCGCTTGCCCGG - Intronic
1062439944 9:136565223-136565245 AACCCAGGACTGCGCTTGCGGGG - Intergenic
1062439955 9:136565268-136565290 CACCCAGGACTCCGCTTGCAGGG - Intergenic
1062605947 9:137348917-137348939 TCACGGGGGCTGCGCTTGCCTGG - Intronic
1062711139 9:137975794-137975816 TTCCCAGGGCTGAGCCTTCCAGG - Intronic
1187842577 X:23504451-23504473 TAACTAGGGCTGCTCTTGGCTGG - Intergenic
1190560254 X:51679782-51679804 TACCCTGGGCTGTGTTTGCGTGG + Intergenic
1190564037 X:51713539-51713561 TACCCTGGGCTGTGTTTGCGTGG - Intergenic
1195529021 X:105930898-105930920 TTGCCAGGGGTGGGCTTGCCAGG + Intronic
1199201477 X:145095019-145095041 TACCCAGTGCTGCAGTTTCCCGG + Intergenic