ID: 1062125298

View in Genome Browser
Species Human (GRCh38)
Location 9:134857260-134857282
Sequence TGAAGCACCTGGACAAGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062125295_1062125298 21 Left 1062125295 9:134857216-134857238 CCCTCTGAGAGAAGAACATGATT No data
Right 1062125298 9:134857260-134857282 TGAAGCACCTGGACAAGAAGCGG No data
1062125296_1062125298 20 Left 1062125296 9:134857217-134857239 CCTCTGAGAGAAGAACATGATTG No data
Right 1062125298 9:134857260-134857282 TGAAGCACCTGGACAAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062125298 Original CRISPR TGAAGCACCTGGACAAGAAG CGG Intergenic
No off target data available for this crispr