ID: 1062126432

View in Genome Browser
Species Human (GRCh38)
Location 9:134865384-134865406
Sequence CTCGTGGTGGACCAGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062126421_1062126432 12 Left 1062126421 9:134865349-134865371 CCAAAAACCCTAGTAGGCGCCAT No data
Right 1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG No data
1062126423_1062126432 5 Left 1062126423 9:134865356-134865378 CCCTAGTAGGCGCCATGGTCTGA No data
Right 1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG No data
1062126425_1062126432 -7 Left 1062126425 9:134865368-134865390 CCATGGTCTGAGCCTGCTCGTGG No data
Right 1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG No data
1062126419_1062126432 25 Left 1062126419 9:134865336-134865358 CCAGGGATGGCTTCCAAAAACCC No data
Right 1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG No data
1062126424_1062126432 4 Left 1062126424 9:134865357-134865379 CCTAGTAGGCGCCATGGTCTGAG No data
Right 1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062126432 Original CRISPR CTCGTGGTGGACCAGGGGCC AGG Intergenic
No off target data available for this crispr