ID: 1062127237

View in Genome Browser
Species Human (GRCh38)
Location 9:134870314-134870336
Sequence GTGTGGGTGCAGAGGTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062127227_1062127237 -5 Left 1062127227 9:134870296-134870318 CCTGGCCCACCCGGCCTAGTGTG No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127224_1062127237 8 Left 1062127224 9:134870283-134870305 CCGCTGCCTGGAGCCTGGCCCAC No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127218_1062127237 24 Left 1062127218 9:134870267-134870289 CCCCACGGTTCCGACTCCGCTGC No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127230_1062127237 -10 Left 1062127230 9:134870301-134870323 CCCACCCGGCCTAGTGTGGGTGC No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127226_1062127237 2 Left 1062127226 9:134870289-134870311 CCTGGAGCCTGGCCCACCCGGCC No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127219_1062127237 23 Left 1062127219 9:134870268-134870290 CCCACGGTTCCGACTCCGCTGCC No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127220_1062127237 22 Left 1062127220 9:134870269-134870291 CCACGGTTCCGACTCCGCTGCCT No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data
1062127222_1062127237 14 Left 1062127222 9:134870277-134870299 CCGACTCCGCTGCCTGGAGCCTG No data
Right 1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062127237 Original CRISPR GTGTGGGTGCAGAGGTCCGT GGG Intergenic
No off target data available for this crispr