ID: 1062128764

View in Genome Browser
Species Human (GRCh38)
Location 9:134881245-134881267
Sequence CTGACTGGTGTCTACCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062128764_1062128774 25 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128774 9:134881293-134881315 GAGAGACAGGGTGTGAGGTGGGG No data
1062128764_1062128771 20 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128771 9:134881288-134881310 TCACAGAGAGACAGGGTGTGAGG No data
1062128764_1062128765 -9 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128765 9:134881259-134881281 ACCAGTCAGATATTCTGCCATGG No data
1062128764_1062128773 24 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128773 9:134881292-134881314 AGAGAGACAGGGTGTGAGGTGGG No data
1062128764_1062128769 13 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128769 9:134881281-134881303 GTCGCCATCACAGAGAGACAGGG No data
1062128764_1062128772 23 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128772 9:134881291-134881313 CAGAGAGACAGGGTGTGAGGTGG No data
1062128764_1062128768 12 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128768 9:134881280-134881302 GGTCGCCATCACAGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062128764 Original CRISPR CTGACTGGTGTCTACCCAGC TGG (reversed) Intronic
900879908 1:5373336-5373358 CTGGCTAATGTGTACCCAGCTGG - Intergenic
902826009 1:18974796-18974818 CTGAATGGTGTCCTCGCAGCTGG + Intergenic
903371293 1:22837802-22837824 CTGGCTCTTGTTTACCCAGCTGG + Intronic
905654751 1:39678859-39678881 CTGACTGGCCTCCACCAAGCAGG + Exonic
905931320 1:41789797-41789819 CTGTCTGGTCCCAACCCAGCCGG - Intronic
907111643 1:51931797-51931819 CTGAGTGGGGTCTCACCAGCTGG + Intronic
913088092 1:115457654-115457676 CTGAGTGCTGTTTAGCCAGCAGG - Intergenic
915167259 1:153955046-153955068 CTGGCTGGGGTCTACTCACCTGG + Exonic
915654420 1:157347713-157347735 CTGGCAGGTGTCTCCCCAACAGG + Intergenic
916500362 1:165381868-165381890 CTGAGTGGTTTCTACAGAGCTGG + Intergenic
917437930 1:175039965-175039987 CTCACTGGTTTCTAGACAGCAGG - Intergenic
919572679 1:199268484-199268506 CTGGCTGGAGTGTAACCAGCTGG - Intergenic
923209954 1:231794876-231794898 CTGAGTAGTGTCTCACCAGCAGG - Intronic
923362869 1:233229400-233229422 CTGCCTGGTGTCATCTCAGCAGG + Intronic
1063796224 10:9516801-9516823 CTGAATTGTGTCTTCCCAGTAGG + Intergenic
1068092320 10:52447861-52447883 CTGACTGTTTGCTACACAGCGGG + Intergenic
1069592688 10:69651772-69651794 CTGGCTGGTGTGAACCCAGCGGG - Intergenic
1070559252 10:77553500-77553522 TTGCCTGGTGACTGCCCAGCAGG - Intronic
1073315667 10:102579017-102579039 CTGACAGGTGTCTAAACAGATGG + Intronic
1076339025 10:129729870-129729892 CTGACTGCTCTCCACCCAGGTGG - Intronic
1076738866 10:132471227-132471249 CAGACCGGTGTCCAGCCAGCAGG - Intergenic
1082890970 11:58138239-58138261 CTGATTTGTGCCTCCCCAGCTGG + Intronic
1083967976 11:66054516-66054538 CTGACTTGTCCTTACCCAGCTGG + Intronic
1089075616 11:115736201-115736223 CTGACTAATGTCTACCCCTCAGG - Intergenic
1090469875 11:126970871-126970893 CTGCCAGGTATCTACGCAGCAGG + Intronic
1102129291 12:110513053-110513075 GAGACTGGTGTCAACCCAGGAGG - Intronic
1102552606 12:113702594-113702616 CCGACTGGGGGCAACCCAGCTGG - Intergenic
1107443816 13:40452257-40452279 CTGACTGGTGTCTAGCCAGTGGG - Intergenic
1108389568 13:49935518-49935540 CTGACTGGCCTCTTCCCAACAGG - Intronic
1108655956 13:52533229-52533251 CTGCCTGGTGCCCACCCTGCTGG + Intergenic
1109140563 13:58709980-58710002 CTGACTGGGGTTTATACAGCAGG - Intergenic
1109245702 13:59952474-59952496 CTGATTGGTGTCTACAAACCAGG - Intronic
1109519123 13:63485564-63485586 CTGAGTGGTGTCCACACAACAGG - Intergenic
1112339714 13:98543097-98543119 ATGACTGGTCTCCTCCCAGCCGG - Intronic
1117173506 14:53125023-53125045 CTGACTGGTGTCTTCACAAGAGG - Intronic
1117457422 14:55912229-55912251 CTGACTGCTGTCTACCCAGCAGG - Intergenic
1119395853 14:74326057-74326079 TTGCCTGGAGTTTACCCAGCTGG + Intronic
1121315969 14:92961206-92961228 CTGCCTGGGGTCTCCCCAGTGGG - Intronic
1122774839 14:104112530-104112552 CTGCCTGGTGTCTAACCTGAAGG + Exonic
1128332771 15:66766657-66766679 CTTGCTGGGGTCTACCCAGCAGG - Intronic
1129786497 15:78313547-78313569 CTGACTGAGGTCTGCCCAGCAGG - Intergenic
1130441993 15:83963704-83963726 CTGAGAGGTGTCTCCCCATCAGG - Intronic
1131880370 15:96856125-96856147 CTGCCTGATGTCAACCCACCTGG - Intergenic
1133374101 16:5269498-5269520 CTGAATGTTGTCTACCCACATGG + Intergenic
1135175483 16:20224153-20224175 CTGACTGATTTCTACCCTACAGG + Intergenic
1135231167 16:20709160-20709182 CTGAATGGCGTCAACCCAGGAGG + Intronic
1139464705 16:67148340-67148362 CTGACTGGTGTCTTCCCATTTGG + Exonic
1141310915 16:82912456-82912478 ATGACTGGGGTCTTCCCAGCTGG + Intronic
1141609594 16:85173821-85173843 CAGGCTGGTGTCTGCCCAGAAGG + Intronic
1143263061 17:5614576-5614598 CAGACTGGAGCCTACCCTGCAGG - Intronic
1144761379 17:17709470-17709492 CTGACTGTGGTCAACCCAGCAGG - Intronic
1148131996 17:45267606-45267628 CTGCCTGTTGTCTCCTCAGCTGG + Exonic
1148872963 17:50669206-50669228 CTCCCTGGTGTCTGCCCTGCTGG + Exonic
1151250073 17:72827585-72827607 CTTCCTGGTGTCTCCCCACCTGG - Intronic
1154068566 18:11131854-11131876 CTGAGTGGTGTCCACACAACAGG - Intronic
1155455238 18:26005004-26005026 CGGGCTGGTGTCAACCCATCTGG - Intergenic
1161606368 19:5216949-5216971 TTGACTGGTGTCCAGCCAGAGGG - Intronic
1162822143 19:13229503-13229525 CCCTCTGGTGTCTACCCAGATGG + Intronic
1163847900 19:19647528-19647550 CAGCCTGCTGTCTACCCTGCAGG - Exonic
1167345207 19:48941231-48941253 ATGAATGGTATCTAGCCAGCTGG - Intronic
926765566 2:16320266-16320288 CTGAGTGGTGTATTCCCAGAGGG - Intergenic
927428681 2:23008405-23008427 CTGACAGGAGTTTTCCCAGCTGG + Intergenic
931212024 2:60206774-60206796 CTGAGTGGTGTCTCCCCATCAGG + Intergenic
935124614 2:100212638-100212660 CTGTCTGGTGTCTTCCCCGGGGG - Intergenic
937894490 2:126968506-126968528 CTGAGTGGATTCTCCCCAGCAGG - Intergenic
943066189 2:183089259-183089281 CTGACTGTTGGCTATTCAGCAGG + Intronic
943105812 2:183544284-183544306 CTGAGAGGTGTCTCCCCATCAGG - Intergenic
948846636 2:240686010-240686032 CTGACTGGGGACCACCCAGCAGG - Intergenic
1170469538 20:16654760-16654782 CTGGCTGTGGTCTACCCAGATGG + Intergenic
1173905369 20:46624497-46624519 TTGCCTTGTGTCTACCCAGCAGG - Intronic
1176051053 20:63119979-63120001 CTCACTGGTGTGTACCGGGCTGG - Intergenic
1176151071 20:63590928-63590950 CAGGCTGGTGTCTACCCCGAGGG - Intronic
1176234234 20:64046865-64046887 CAGAATGGTGTGAACCCAGCAGG + Intronic
1181471975 22:23146050-23146072 TTGACAGGTGTCTACCAAGGAGG - Intronic
1183090616 22:35519555-35519577 CTGCCTGGCGTCTATACAGCAGG + Intergenic
1183147738 22:36010122-36010144 CTGCCTGCATTCTACCCAGCAGG - Intronic
1183391879 22:37549974-37549996 CTGGCTGGCGCCTACCAAGCAGG - Intergenic
951532428 3:23710284-23710306 TTAACTGTTGTCTCCCCAGCAGG + Intergenic
952362468 3:32644807-32644829 CAGACAGGTGTCTCCCCATCCGG - Intergenic
955476509 3:59341586-59341608 CTGACTGTGGTCTAGCTAGCTGG + Intergenic
956602298 3:71034893-71034915 CTGTCTGGTGGCTCCCCAGTGGG + Intronic
957068171 3:75543585-75543607 CCGACTGTTGTCTACCCACATGG - Intergenic
957785956 3:84883692-84883714 CTGTCTGCTTTCTACACAGCTGG - Intergenic
958541626 3:95482454-95482476 CTGAAGGCTGTCTACCCAGTTGG + Intergenic
958667539 3:97160174-97160196 CTGACTGGTATCTACAGAACAGG + Intronic
961905620 3:130260117-130260139 CTGACTGGGGTCTAGCCAACGGG - Intergenic
962328264 3:134454094-134454116 CTTCCTGGGGTCTACCCTGCTGG + Intergenic
962751370 3:138436692-138436714 CTGAAAGGTGTGGACCCAGCAGG + Intronic
966751729 3:183328482-183328504 CTGATTGGTGTCTAGACAGTTGG + Intronic
969299440 4:6288965-6288987 CTGACTGGTGTCTGGCTTGCAGG + Exonic
969800694 4:9562493-9562515 CTGAATGTTGTCTACCCACATGG + Intergenic
973143108 4:46793273-46793295 CAGACTGGTATCTTCCCGGCTGG + Intronic
983352665 4:166612620-166612642 CTGACTTGTGTCCTACCAGCAGG + Intergenic
983640742 4:169942021-169942043 CTTTCTGGTGTCTATCCAGAAGG - Intergenic
984856745 4:184201986-184202008 CTCACTGCTTGCTACCCAGCTGG - Intronic
985241050 4:187931159-187931181 CTCACTCTTGTCTCCCCAGCTGG + Intergenic
985530099 5:429166-429188 CTCACTGGTGTGTTCCCAGCAGG - Intronic
986464847 5:8010932-8010954 CTAACTGGTTCCTACCCAGATGG + Intergenic
988400800 5:30757635-30757657 CAGGCTGTTGTCTATCCAGCTGG - Intergenic
991234255 5:64375922-64375944 CTGACTGGTGTCTACAGAACAGG - Intergenic
993252868 5:85550484-85550506 CTGACCGGTTCCTACCCACCTGG + Intergenic
993343168 5:86750410-86750432 CAGAATGGTGTGTACCCAGGAGG - Intergenic
1000742282 5:164984818-164984840 ATGACTGTTTTCTACCCAGTTGG - Intergenic
1003396969 6:5761939-5761961 CTCACTGGTGTGCACACAGCAGG - Intronic
1004519645 6:16349566-16349588 CTGACTGGTGTCTATGATGCAGG - Intronic
1007721320 6:43887081-43887103 CTTACAGGTGTTTGCCCAGCAGG + Intergenic
1012467889 6:99536055-99536077 GAGACTGGTGTCAACCCAGGAGG - Intergenic
1019575696 7:1736659-1736681 GCGCCTGGTGTCTCCCCAGCTGG - Intronic
1026902287 7:74043887-74043909 CTGCCAGGTGTATACCCAGGTGG + Exonic
1027047070 7:74998123-74998145 CTGCCTGGGGTCTGCCGAGCCGG - Intronic
1028855317 7:95585677-95585699 ATGACTGGTGTATCCCAAGCAGG - Exonic
1029385926 7:100243517-100243539 CTGCCTGGGGTCTGCCGAGCCGG + Intronic
1032959958 7:137020512-137020534 CTGACTAGAATCTTCCCAGCTGG + Intergenic
1034102423 7:148461406-148461428 CTCACTGGGGTGGACCCAGCAGG + Intergenic
1035361352 7:158315881-158315903 CTGACTGGTGTCCACAGAACAGG - Intronic
1040912037 8:52529175-52529197 CTGAGTGGTGTCTACAAAACGGG - Intergenic
1044165748 8:88981905-88981927 TTAAATGGTGTCTACCTAGCTGG + Intergenic
1049085270 8:140473696-140473718 CTCACTGTTGGGTACCCAGCTGG - Intergenic
1049328933 8:142039412-142039434 CTAACTGGTCTCTACAAAGCAGG - Intergenic
1049459997 8:142722287-142722309 CTGACAGGCTTCTACCCAGTGGG - Intergenic
1059999115 9:119942367-119942389 CTGACTGGTGTCTTGCCACACGG - Intergenic
1062126800 9:134868356-134868378 CTGAATGGTGTCTACCTCGGGGG + Intergenic
1062128764 9:134881245-134881267 CTGACTGGTGTCTACCCAGCTGG - Intronic
1185486528 X:485459-485481 CTGCCTGGTGTGTATACAGCAGG + Intergenic
1185488505 X:500803-500825 CTAATGGGTGTCTACACAGCAGG - Intergenic
1189267623 X:39729067-39729089 CTGACTCGTGGCTACCATGCTGG - Intergenic
1189795420 X:44641586-44641608 CTGCCTGCTCTCTACCCAGGTGG + Intergenic
1192180523 X:68912985-68913007 CTCAGGGGTGTCTCCCCAGCTGG + Intergenic
1193445860 X:81601249-81601271 ATGACTGATGTGTTCCCAGCAGG + Intergenic
1193957386 X:87878975-87878997 CTGAGTGGTGTCCACACAACTGG - Intergenic
1196707819 X:118730792-118730814 CTTACTGGTATCTTCCCACCTGG + Intronic
1198263483 X:134987669-134987691 ATGACTGGTGGCTACGCAGAAGG - Intergenic
1200054802 X:153454669-153454691 CTGATTGGTGACTTCCCCGCTGG - Intronic
1201652560 Y:16306624-16306646 ATGACTGGTGTCTTTCCTGCAGG + Intergenic
1202168498 Y:22016913-22016935 CTGACTGTGGTATACCCAGATGG - Intergenic
1202222863 Y:22569455-22569477 CTGACTGTGGTATACCCAGATGG + Intergenic
1202320252 Y:23626205-23626227 CTGACTGTGGTATACCCAGATGG - Intergenic
1202550515 Y:26043851-26043873 CTGACTGTGGTATACCCAGATGG + Intergenic