ID: 1062128766

View in Genome Browser
Species Human (GRCh38)
Location 9:134881260-134881282
Sequence ACCATGGCAGAATATCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062128766_1062128768 -3 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128768 9:134881280-134881302 GGTCGCCATCACAGAGAGACAGG No data
1062128766_1062128775 22 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128775 9:134881305-134881327 GTGAGGTGGGGATAAGCACCCGG No data
1062128766_1062128774 10 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128774 9:134881293-134881315 GAGAGACAGGGTGTGAGGTGGGG No data
1062128766_1062128773 9 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128773 9:134881292-134881314 AGAGAGACAGGGTGTGAGGTGGG No data
1062128766_1062128772 8 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128772 9:134881291-134881313 CAGAGAGACAGGGTGTGAGGTGG No data
1062128766_1062128769 -2 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128769 9:134881281-134881303 GTCGCCATCACAGAGAGACAGGG No data
1062128766_1062128771 5 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128771 9:134881288-134881310 TCACAGAGAGACAGGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062128766 Original CRISPR ACCATGGCAGAATATCTGAC TGG (reversed) Intronic
903746012 1:25587109-25587131 ATCATGACAGAATTTCTGATCGG - Intergenic
905041523 1:34963929-34963951 AACATGGCAGAAAATCAGAATGG + Intergenic
908056459 1:60292383-60292405 AACATGGCAGCATTTCCGACAGG + Intergenic
910223592 1:84914690-84914712 ACCATTGCAGCATATATGGCTGG - Intergenic
911787653 1:101970569-101970591 AGCCTGGCAGAATGCCTGACAGG - Intronic
912101266 1:106209113-106209135 ACCATTTTAGAATTTCTGACTGG + Intergenic
912486233 1:110031065-110031087 ACCATGGCTGAAAATGTTACAGG + Intergenic
915782322 1:158566514-158566536 ACAATGACAGAACATCTGAAAGG + Intergenic
918225534 1:182477788-182477810 ACCAGCCCAGAATCTCTGACTGG + Intronic
919930650 1:202219280-202219302 GCCATGGCAGGATATGTGCCCGG + Intronic
1063272522 10:4527088-4527110 ACCAGGGCAGAATATATATCTGG - Intergenic
1074383253 10:112997091-112997113 AACATTGCAGAATGTCTGCCAGG + Intronic
1077585090 11:3445310-3445332 ACCATTGCAGAATGTTTGATTGG + Intergenic
1077713046 11:4554754-4554776 CCCATTGCAGAACATGTGACAGG - Intergenic
1081910130 11:46695162-46695184 AGCAGGGCAGCATATCTGCCAGG + Intronic
1082697074 11:56381460-56381482 AGCATGTTGGAATATCTGACTGG + Intergenic
1082701468 11:56436896-56436918 ACCATTGCAGAATTTCTGTGCGG + Intergenic
1089456495 11:118628681-118628703 TCCATGGCAGAGTCTCTGCCAGG + Intronic
1089898982 11:121961663-121961685 ACCCTGTTAGAACATCTGACTGG + Intergenic
1098008386 12:66023001-66023023 AACATAGCAGAAAATCTGACAGG + Intergenic
1101535761 12:105614739-105614761 TCCAAGGCAGAATCTCTGCCAGG - Intergenic
1105402608 13:20109323-20109345 ACCATGACAGGATATCCTACAGG + Intergenic
1111818473 13:93184595-93184617 ACCAGGGCATAACATCTGAGGGG - Intergenic
1120464142 14:84834086-84834108 ACCATGCCAGCATATCTTAGGGG + Intergenic
1127771080 15:62231195-62231217 ACCATGGAAGAAAATTTGAAAGG + Intergenic
1135687567 16:24510429-24510451 ACCATGGCAGTGACTCTGACTGG + Intergenic
1138511955 16:57513838-57513860 ACCATGGCACAATAGCTGTTAGG + Intronic
1139227689 16:65249084-65249106 ACCTTGGGAGAATCTCTGATGGG - Intergenic
1139907929 16:70379567-70379589 ACTATTGCAGAAAATCTGGCTGG + Exonic
1141059282 16:80850554-80850576 ACCATGGCAGTAAGTTTGACTGG - Intergenic
1141309739 16:82901926-82901948 ACCATCCCAGAAAATCTGAGCGG + Intronic
1143770519 17:9165550-9165572 ACCCTGGGAGAATAACTCACAGG + Intronic
1155606129 18:27608174-27608196 TCCATGGCAGGATACCTGCCCGG - Intergenic
1162287124 19:9747092-9747114 ACCAAGGAATTATATCTGACAGG - Intergenic
1164718822 19:30416419-30416441 ACCACAGAAGAATATCTGCCAGG - Intronic
1164968588 19:32510021-32510043 ACCCTGGCAAAATATCAGCCTGG - Intergenic
1165536507 19:36451710-36451732 ACTATGGAAGAATTTCTGCCAGG + Intronic
927494022 2:23540414-23540436 ACCATTGCAGAAAATCGTACTGG + Intronic
930660114 2:54044768-54044790 AACATGGCAGCAGATGTGACAGG - Intronic
939814186 2:146873817-146873839 ACCTTGGCATAGTATCTCACTGG - Intergenic
940603961 2:155896444-155896466 TACAGGGCAAAATATCTGACTGG + Intergenic
942534990 2:176953786-176953808 ACTATGGCTGAATAGCTGGCTGG - Intergenic
943162717 2:184276186-184276208 ATCATGGCAGATTTTCTGAGAGG - Intergenic
943279051 2:185908041-185908063 ACCATGGTTGAATATCAAACAGG - Intergenic
946766712 2:223047303-223047325 AACAGGGCTGGATATCTGACAGG - Intergenic
947969610 2:234311858-234311880 ATCATGGCAGAAGATTTCACTGG - Intergenic
948788245 2:240364253-240364275 TCCATGGCAGAATCTCAGCCGGG - Intergenic
1170374260 20:15682936-15682958 ACCAGAGCATGATATCTGACAGG - Intronic
1177633105 21:23751958-23751980 ACCTTGGCTCAAAATCTGACAGG + Intergenic
953926618 3:46985843-46985865 ACCAAGGCAGAAGCTCTGAGAGG + Intronic
956506567 3:69946616-69946638 AGCATGGCAGAATATTTTGCTGG - Intronic
957563996 3:81861792-81861814 AACTTGGCAGAATGTCTGACTGG - Intergenic
962613500 3:137101709-137101731 ATCATGGTAGATTATCTGGCTGG - Intergenic
963076118 3:141347742-141347764 ACCATGGCAGCCTTTCTGGCAGG - Intronic
965410461 3:168323990-168324012 ACCATGACAGAAGATCTGTTAGG + Intergenic
966112248 3:176417139-176417161 CCCCTGGCAGAACCTCTGACTGG - Intergenic
969000278 4:3975201-3975223 ACCATTGCAGAATGTTTGATTGG + Intergenic
969842579 4:9893305-9893327 AGCCTGGAAGAATACCTGACAGG + Intronic
975935746 4:79577854-79577876 AACATGGCAGCATAGCTGACTGG + Intergenic
976901603 4:90184126-90184148 GCCATGGCAAAATGTCTTACAGG - Intronic
978318790 4:107470099-107470121 CCCATAGCAGGAGATCTGACTGG + Intergenic
980190022 4:129512400-129512422 ACAATGGCAGTACATGTGACAGG - Intergenic
982649153 4:158064783-158064805 ACAATGTCAGAATATCAGATGGG - Intergenic
982684955 4:158477015-158477037 ACAAAGTCAGAATATCTGAGAGG - Intronic
983829784 4:172312135-172312157 ACCATGGCACTAAATCTGTCTGG - Intronic
989445354 5:41522101-41522123 ACCATGGATGAACATCTAACTGG - Intergenic
994862289 5:105212834-105212856 ACCATGGGTGAATATTTGCCAGG - Intergenic
995105012 5:108367101-108367123 ACCATGGCAGAATTTAGAACAGG + Intronic
998055624 5:139074473-139074495 ACCCTAGCAAAATATCTGTCAGG - Intronic
1003133552 6:3415983-3416005 ACCATGGAAGAGACTCTGACTGG - Intronic
1006151256 6:31991449-31991471 ACCGTGGCAGAAACTTTGACAGG - Exonic
1006157557 6:32024187-32024209 ACCGTGGCAGAAACTTTGACAGG - Exonic
1007105725 6:39281699-39281721 GCCATGGCAGGATAGGTGACAGG + Intergenic
1007345888 6:41229140-41229162 ACCACAGCAGAATACCTGGCAGG - Intronic
1007640612 6:43336462-43336484 AACATGGAAGAATATCTGGCAGG - Exonic
1008100074 6:47380675-47380697 ACAATGGCAGAAAATTTGAAGGG + Intergenic
1016355553 6:143214521-143214543 ACCATTGCAGAATATGTGATGGG + Intronic
1017391103 6:153940403-153940425 TCCGTGGCACAATTTCTGACTGG + Intergenic
1019286699 7:226848-226870 ACCATTGCAGAGAATCTGACAGG + Intronic
1028965004 7:96792269-96792291 ACCATGGCAGAAAGTCTCAGTGG - Intergenic
1032254711 7:130287768-130287790 ACCAAGGGAGAATAAGTGACTGG - Intronic
1036056045 8:5255099-5255121 CCCATGGCAGTATTTCTGAAAGG + Intergenic
1036852588 8:12214347-12214369 ACCATTGCAGAATGTTTGATTGG + Intergenic
1036873957 8:12456870-12456892 ACCATTGCAGAATGTTTGATTGG + Intergenic
1044795946 8:95897754-95897776 ACCATGAAAGAAAGTCTGACTGG - Intergenic
1052788339 9:32850866-32850888 ATTATAGCAGAATGTCTGACAGG + Intergenic
1055828814 9:80357619-80357641 ATCATGGCAGCAGATCTCACTGG - Intergenic
1059173427 9:112148009-112148031 ACCAAGGCAGAATCTCTCAAAGG - Intronic
1059980599 9:119767475-119767497 ACAAGGGCAGAATAGCTGAAAGG - Intergenic
1062128766 9:134881260-134881282 ACCATGGCAGAATATCTGACTGG - Intronic
1186680252 X:11865710-11865732 ACTAGGGCAGAATATGTTACTGG + Intergenic
1187102710 X:16211337-16211359 ACGATGCCAGAATTTCTGCCAGG + Intergenic
1188777180 X:34234328-34234350 AATATGGCACAATATCTCACTGG + Intergenic
1194307247 X:92262771-92262793 ACCATAACAGAATATCTAATTGG + Intronic
1194540830 X:95170214-95170236 ACCATGACAGTATAGCTGAGAGG + Intergenic
1197895501 X:131309311-131309333 ACTATGACAGAATACCTGAGGGG - Intronic
1199435484 X:147807862-147807884 AACATGGTAGACTATGTGACTGG - Intergenic