ID: 1062128768

View in Genome Browser
Species Human (GRCh38)
Location 9:134881280-134881302
Sequence GGTCGCCATCACAGAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062128764_1062128768 12 Left 1062128764 9:134881245-134881267 CCAGCTGGGTAGACACCAGTCAG 0: 1
1: 1
2: 1
3: 12
4: 123
Right 1062128768 9:134881280-134881302 GGTCGCCATCACAGAGAGACAGG No data
1062128766_1062128768 -3 Left 1062128766 9:134881260-134881282 CCAGTCAGATATTCTGCCATGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1062128768 9:134881280-134881302 GGTCGCCATCACAGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062128768 Original CRISPR GGTCGCCATCACAGAGAGAC AGG Intronic
No off target data available for this crispr