ID: 1062133150

View in Genome Browser
Species Human (GRCh38)
Location 9:134911074-134911096
Sequence CTTGGAAAGCAGAGAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 1, 2: 4, 3: 34, 4: 384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062133150 Original CRISPR CTTGGAAAGCAGAGAGAACC TGG (reversed) Intronic
901218198 1:7566529-7566551 GTTGATGAGCAGAGAGAACCTGG + Intronic
902300579 1:15499935-15499957 CTTGGAAAACAGAGAGGTCCTGG + Intronic
902946884 1:19847306-19847328 CTTGGAATGAATGGAGAACCTGG - Intergenic
903059237 1:20658083-20658105 CTTGTAAAGCTGACAGAACACGG + Intronic
904858212 1:33515845-33515867 CTGGGAAAGAAGGGAGAGCCGGG - Exonic
906029328 1:42705185-42705207 CTTGGAAAGCAAACAGAAAGGGG + Intergenic
908033120 1:60022410-60022432 CTTTCAAAGCAGAAAGTACCAGG + Intronic
908666929 1:66503668-66503690 CTCTGAAGGCAGAGAGAACTGGG + Intergenic
910867678 1:91803054-91803076 CTTTTAAAGCAGAGAAAAGCAGG - Intronic
911050228 1:93664783-93664805 CTTGGCAGGCAGAGAGGATCTGG + Intronic
912558827 1:110535621-110535643 CTTGGAAAGGAGAGAGAGAGAGG + Intergenic
913117006 1:115706487-115706509 CCTGGGAACCAGAGAGACCCTGG + Intronic
915399229 1:155610402-155610424 CTGGGGAAGCAGAGAGGACGAGG - Intronic
915416344 1:155745982-155746004 CTGGGGAAGCAGAGAGGACGAGG - Intergenic
915796182 1:158736182-158736204 CTTGGAAACATGAGTGAACCAGG + Intergenic
916205568 1:162313150-162313172 CTTGGAATGCAAAGACAAACAGG + Intronic
916350503 1:163844249-163844271 CTTAGAAAGCAGATTGAATCTGG + Intergenic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
917710575 1:177680157-177680179 GTTGGAAAACAGAGATAAGCAGG - Intergenic
918405461 1:184207839-184207861 CTTGGTAATCAGATATAACCTGG + Intergenic
919781455 1:201223978-201224000 CACGGAAAGCAGAGAGAACAAGG - Intronic
919791656 1:201294750-201294772 CTTAGAAAGCAGACAGAGCCAGG - Intronic
921608331 1:217180779-217180801 TTTGGAAAGAGGAGCGAACCAGG + Intergenic
922745621 1:228041825-228041847 CTTGGTAAGGAGAATGAACCAGG - Intronic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
924504416 1:244667808-244667830 TTAGGATAGCAGAGAGAAGCAGG + Intronic
924745515 1:246830130-246830152 CTTGGATAACAAAGAGAAACTGG - Intergenic
924826858 1:247548859-247548881 CCTTGAAAGCAAAGTGAACCTGG + Intronic
1062965276 10:1602304-1602326 CATTGAAAGCAGAGTGGACCTGG - Intronic
1063910182 10:10821380-10821402 CATGGAAAGGCGAGAGTACCAGG + Intergenic
1065859988 10:29864479-29864501 GTTGGATTGCCGAGAGAACCAGG - Intergenic
1066239773 10:33522328-33522350 ATTGGGAAGGAGACAGAACCAGG + Intergenic
1068961040 10:62866914-62866936 CTTGGAAGCCACAGGGAACCAGG - Intronic
1069253454 10:66301188-66301210 CTTCCAAAACAGAAAGAACCAGG + Intronic
1069768348 10:70880796-70880818 CCTGGAAACCAGAGAGAAAGAGG + Exonic
1069851711 10:71409583-71409605 AGTGGAAAGCAGAGGGCACCCGG + Intronic
1070526747 10:77302165-77302187 CTTGGAAATCAGAGGGACCAGGG - Intronic
1070750035 10:78958581-78958603 CTTGGAGAGCAGAGAGAGCAGGG + Intergenic
1072327404 10:94311928-94311950 CTTAGAAAGCAGAGAGCTCATGG + Intronic
1073814447 10:107190926-107190948 CTTGTAAAGCACAGAGGACTGGG - Intergenic
1073965052 10:108979053-108979075 CTTGGAAAGTAGTAAGAACCAGG - Intergenic
1075063757 10:119274946-119274968 TTTGCAAAGCAGTAAGAACCTGG + Intronic
1075317474 10:121464554-121464576 TTTGGAAAGCAGAGGCAACCTGG + Intergenic
1076842931 10:133055464-133055486 CTTAGAAACCAGGGAGACCCTGG - Intergenic
1077434383 11:2531742-2531764 CTTGGAAGGCAGAGAGACCCTGG + Intronic
1077872009 11:6270493-6270515 CTGGGAAGGGAGAGAGAACTGGG - Intronic
1079156849 11:17955921-17955943 CTTGGAAAGTAGAGAGCTGCTGG + Intronic
1079188803 11:18260618-18260640 CATGGAAAGCAAAGAGGACGAGG - Intergenic
1079752339 11:24214644-24214666 ATTGGAAAACAGAAAGAAGCAGG + Intergenic
1080694230 11:34586968-34586990 CTTGGCAAGGAGATAGAATCAGG - Intergenic
1081411277 11:42761125-42761147 ATTGGATTCCAGAGAGAACCAGG - Intergenic
1081587575 11:44397973-44397995 CTTAGATAGCAGAGAGAGACAGG + Intergenic
1082246778 11:49932482-49932504 CTTCCAAAGCAGAAAGCACCAGG + Intergenic
1083268989 11:61561277-61561299 CCTGGAAGGCAGGGTGAACCAGG + Intronic
1083313841 11:61802116-61802138 GTTGGTGAACAGAGAGAACCAGG - Exonic
1083848577 11:65351993-65352015 AATGGAGAGCAGAGAGAAACTGG - Exonic
1084148219 11:67276062-67276084 CATGGCAAGCACAGAGAACCTGG + Intronic
1084593757 11:70105210-70105232 CTTGGAGAGCAGGGAGAGCAGGG + Intronic
1084967843 11:72753634-72753656 CTTGGGCAGCAGAGGGCACCTGG + Intronic
1086576241 11:88341731-88341753 CTGGGAAAGCTGAGGGCACCAGG - Intergenic
1088409889 11:109522682-109522704 CATGGAAAGAACAGAGAATCTGG + Intergenic
1088536680 11:110868976-110868998 CTTGGAAAGGAGAGAGAGCAGGG + Intergenic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1090255493 11:125280897-125280919 CCTGGAAAGCAGGCAGAACTAGG - Intronic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1092717176 12:11402491-11402513 CTTGGGAAGAAGAGAGAATATGG + Intronic
1096594145 12:52683880-52683902 CTTGGAAGACAGAGAGGAACAGG - Intergenic
1097244794 12:57601614-57601636 CTTGAACATCAGAGAGAACCAGG - Exonic
1097317221 12:58184803-58184825 CTTGGAACTAAGAGAAAACCTGG + Intergenic
1097817582 12:64091478-64091500 CTGGGAAAGCAAAGAGCCCCAGG - Intronic
1097968944 12:65611526-65611548 CTTGGAAAAAATAGCGAACCAGG + Intergenic
1098231030 12:68371759-68371781 CTTGGAAGGGAGTGAGAACAGGG + Intergenic
1098411856 12:70194543-70194565 CTTTGAAAGCAGAGAGATTTGGG - Intergenic
1100330203 12:93573916-93573938 CTTAGAAAGCAGAGTGGGCCGGG + Intronic
1100968771 12:100043939-100043961 CCTGGGAAGCAGTGAGAAACAGG - Intronic
1101586973 12:106093681-106093703 CCTGGAAAGCAGAGAGGATGAGG + Intronic
1102804314 12:115765924-115765946 CTTTGAAAGCAGAGAGAATGAGG + Intergenic
1102823599 12:115927804-115927826 CTTGGATGGCAGAATGAACCTGG - Intergenic
1103972465 12:124680686-124680708 CTTTTAAAAAAGAGAGAACCAGG - Intergenic
1104047505 12:125173529-125173551 CATGGAGAACAGAGAAAACCAGG - Intergenic
1104772148 12:131370120-131370142 TGTGGTAAGCAGTGAGAACCAGG + Intergenic
1105427098 13:20303131-20303153 CTTGGTGAGCAGAAAGAACATGG - Intergenic
1105997480 13:25686245-25686267 GTTGGAAATCAGAGAGAATAGGG + Intronic
1107003956 13:35585596-35585618 TTTGCAAAGAAGAGAGAAGCTGG - Intronic
1107243908 13:38269308-38269330 AATGGAAAGCAGAGAAAAGCAGG + Intergenic
1107592862 13:41926629-41926651 CTTGGAAATCACAGAGAAGATGG + Intronic
1110755731 13:79171818-79171840 CTTGGAAATCAGAGACAAAAGGG - Intergenic
1111847701 13:93532574-93532596 CTTAGAAAGCAGAAAGCATCTGG - Intronic
1115876591 14:37868423-37868445 CTTCAAAAGGAGAGAGAACATGG - Intronic
1115927443 14:38451019-38451041 ATTGGAAAGCAGAAAAAAGCAGG + Intergenic
1118140614 14:63077071-63077093 CTAGTAAAGCAGAGATAAGCTGG - Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1120867096 14:89304690-89304712 CTTGGAAACCAGAGAAAACCTGG + Intronic
1124161154 15:27271370-27271392 CGTGGAAAGCAGTGAGCACGAGG - Intronic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1126250960 15:46567013-46567035 CTTGCAAAGAAGTGAGGACCAGG + Intergenic
1126410362 15:48367578-48367600 GTTGGAAGGAATAGAGAACCAGG + Intergenic
1126530544 15:49705435-49705457 CGTGGAACACAGAAAGAACCCGG - Intergenic
1127373317 15:58360005-58360027 CCAGGACAGCAGAGGGAACCAGG - Intronic
1127385330 15:58462207-58462229 CTTTGAAGGCAGAGAGAGGCTGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127531222 15:59845441-59845463 CTTGGAAATCAGAGATAACTAGG + Intergenic
1127913845 15:63439597-63439619 AGTGGAAAGCACAGAGCACCAGG - Intergenic
1128238124 15:66081194-66081216 CTGGGAATGAAGAGAGAATCAGG + Intronic
1128259338 15:66221570-66221592 CTTAGAAGGCAGAGAGAAGTGGG + Intronic
1128478096 15:68014413-68014435 CTTGGTAAGCAGAGTGAATTGGG + Intergenic
1128679272 15:69636082-69636104 CTTGGAAATCAGAAAGACCTAGG - Intergenic
1129827393 15:78642630-78642652 CTTGGAAAGGACATAAAACCTGG + Intronic
1130794336 15:87193036-87193058 GGTGGAAAGCAGAGAGAAGAAGG + Intergenic
1131386846 15:92015039-92015061 CTTGGACAGCAGAGAAATACTGG + Intronic
1131848425 15:96512632-96512654 CTTTGAAAGCAGACAGACCTGGG - Intergenic
1133323575 16:4929978-4930000 ATTGGAAAGCTTAGGGAACCAGG - Intronic
1133526597 16:6611774-6611796 CTTGGGAAGCAGAGAGAGAAGGG - Intronic
1135047044 16:19164518-19164540 CTTGCAAAGCAGTGGGATCCTGG + Intronic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1135877934 16:26221700-26221722 TTTGGAAGTCAGACAGAACCTGG - Intergenic
1136024823 16:27462608-27462630 TTTGGAAAGCAGAGAGCAAGAGG - Intronic
1136078285 16:27831927-27831949 CTTGGAAAGCAGCGAGTCCAGGG - Intronic
1136983930 16:35082833-35082855 CTTAACAAGCAGAGAGACCCTGG - Intergenic
1137313665 16:47292835-47292857 CTTGGAAGGGAGAGAGAGCATGG - Intronic
1137370322 16:47899159-47899181 AATGGAAAGCAGAGAAAAGCAGG + Intergenic
1138541756 16:57691903-57691925 TTTGGGCAGAAGAGAGAACCAGG - Intergenic
1139924730 16:70479819-70479841 CTGGGCAAGCAGAGAGTGCCTGG + Exonic
1140495324 16:75381625-75381647 CTTGCCAAAGAGAGAGAACCTGG - Intronic
1140746818 16:77987829-77987851 CTTGGACATTAGAGAGAACTTGG - Intergenic
1141012309 16:80414244-80414266 CTTGGAGACCAGTGAGAACATGG - Intergenic
1142105926 16:88302754-88302776 CCTGGAAAGCAGACAGATGCAGG - Intergenic
1142321852 16:89388264-89388286 CATGGAGAGAAGAGAGCACCCGG - Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143848623 17:9792476-9792498 CTTGGAAATTAGAAATAACCAGG + Intronic
1144248704 17:13394336-13394358 CTTGGAAAGGAGAGTGATGCTGG + Intergenic
1145808751 17:27752460-27752482 ATTGGAAAGCAGTGAAACCCAGG + Intergenic
1145990725 17:29077889-29077911 TTTGGAAAGCAAAGAGGGCCAGG - Exonic
1146595283 17:34162996-34163018 ATTGGAAAGTGGAGAGAAGCCGG - Intronic
1146637859 17:34519417-34519439 CATGGAAACCAGGCAGAACCTGG + Intergenic
1147547321 17:41412021-41412043 CCTGGAAAACAGAGAAAACAAGG + Intergenic
1147859893 17:43513002-43513024 CTGGGAAAGCAGAGATTTCCTGG - Intronic
1148027836 17:44600636-44600658 CTTGGATGGCAGACAGACCCGGG + Intergenic
1148068240 17:44889357-44889379 ATTGGAAAGCAGGGAAAATCTGG + Intronic
1148141721 17:45333796-45333818 CTTGGAAAGCACTGTGAGCCTGG + Intergenic
1148464799 17:47858301-47858323 CTTGGAAAGCAGAAAGCAGTTGG - Intergenic
1149094430 17:52824152-52824174 CTTGGAAAGCACAAACAACCAGG + Intergenic
1149610107 17:57953769-57953791 CTTGAATAGAAGAGAGACCCTGG - Intronic
1150208075 17:63424217-63424239 CCTGGAAAACTGAGAGACCCTGG - Exonic
1150677699 17:67259087-67259109 GTGGGAAAGCAGAAAGCACCAGG + Intergenic
1151313899 17:73310689-73310711 CTGGGAAAACACAGGGAACCTGG + Intronic
1151391782 17:73792007-73792029 CTCTGAAAGCTGAGAGCACCTGG + Intergenic
1152276157 17:79358759-79358781 CTCAGAAAAGAGAGAGAACCAGG - Intronic
1152895265 17:82907287-82907309 CTTGGAAAACAGACAGGTCCAGG - Intronic
1155088921 18:22487243-22487265 CTTTGAAAGCAGAGATACCCAGG + Intergenic
1155115369 18:22760708-22760730 AATGGAAAGCAGAGAAAATCAGG + Intergenic
1155740888 18:29286279-29286301 CTTAAAAATCAGAGAGGACCGGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158424855 18:57329724-57329746 CTAGGGAGGCAGAGAGAAGCAGG + Intergenic
1158834573 18:61316815-61316837 TTTGGAAAGCAGAAAGAGACAGG - Intergenic
1159136150 18:64338925-64338947 CTGGGAATGAAGAGAGATCCTGG + Intergenic
1159935305 18:74360966-74360988 CCTGGAAAGCTGAGAGCACCGGG + Intergenic
1159949925 18:74475456-74475478 CTAGGAAAGCAGAGAGGAAGTGG - Intergenic
1160144067 18:76349625-76349647 CTTAGTAAGCAGAGAGAATGTGG + Intergenic
1161614162 19:5260826-5260848 TAAGGGAAGCAGAGAGAACCAGG + Intronic
1163127624 19:15252815-15252837 CCTGGGAAGCAGAGGGCACCAGG + Intronic
1163155474 19:15437892-15437914 CGGGGAAAGCTGGGAGAACCAGG - Intronic
1164576782 19:29409769-29409791 CTTTGACAGCAGAGAGACCTGGG - Intergenic
1167645778 19:50704082-50704104 CTCGGACTGCACAGAGAACCTGG - Intronic
1168084188 19:54033289-54033311 CATACAAAGCAGAGAGACCCCGG - Intergenic
925312176 2:2892613-2892635 AGTGGGAAGGAGAGAGAACCTGG - Intergenic
926353456 2:12018478-12018500 CTTGGAAAGGTAAGAGAATCAGG + Intergenic
929808626 2:45169792-45169814 GTGGGAAAGCAGAGAGAAGGAGG - Intergenic
930228579 2:48820342-48820364 CTTGGAAAGCAGATTGGAACTGG - Intergenic
930558296 2:52928338-52928360 CATGGAATGCAGAGAGAGCCTGG + Intergenic
931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG + Intergenic
932603200 2:73144475-73144497 CTAGAAAAGCTGAGACAACCTGG + Intronic
932616781 2:73236844-73236866 CCTGCAAAGCATAGGGAACCTGG + Intronic
932686758 2:73877105-73877127 CTTGGGGAGTAGAGAGAGCCAGG - Intergenic
932712409 2:74076866-74076888 CTGGAAAAGCTAAGAGAACCAGG - Intronic
933452850 2:82478780-82478802 CTGGGGAAGAAGAGAGAACTAGG - Intergenic
933906131 2:86895022-86895044 CTTGGAAGGCAGTGGAAACCTGG + Intergenic
934011792 2:87827360-87827382 CTTTTAAATCAGAGATAACCTGG + Intergenic
935580806 2:104754636-104754658 CGTGGAAGGCAGAGAGAATTTGG - Intergenic
935766975 2:106378200-106378222 CTTGGAAGGCAGTGGAAACCTGG + Intergenic
935911751 2:107904196-107904218 CTTGGAAGGCAGTGGAAACCTGG + Intergenic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
936366031 2:111856637-111856659 CTTGGAAGGCAGTGGAAACCTGG - Exonic
937610757 2:123857774-123857796 GATGGAAAGCAGAGAAAAGCAGG + Intergenic
937847530 2:126598026-126598048 CTTGGAAAGAAAATAGAACTTGG - Intergenic
938409521 2:131052574-131052596 CTAGGAAGGAAGTGAGAACCAGG - Intronic
938613966 2:132978653-132978675 CTTAGAAACCAGACAGAAGCTGG + Intronic
939984621 2:148817138-148817160 GTGGGAAAGGAGAGAGAGCCAGG - Intergenic
940511675 2:154623209-154623231 AGTGGAAAGCAAAGAGAAACAGG - Intergenic
940781112 2:157934523-157934545 CTTGGAAAGAGAAGAGGACCAGG + Intronic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
942995223 2:182252454-182252476 CATGGAAGGAAGAGAGACCCAGG + Intronic
943135877 2:183912542-183912564 CTTGGGAAACAAAGAGAAGCAGG - Intergenic
943703286 2:191009901-191009923 CATGGAAATCAGACAGTACCTGG - Exonic
944439180 2:199725206-199725228 AATGGAAAGCAGAAAAAACCAGG - Intergenic
945020207 2:205563426-205563448 CTTGGAAACCAGAGAGTCCTGGG - Intronic
946308652 2:218871005-218871027 CCTGGAAAGCAGAGAATAGCAGG - Exonic
948185795 2:236020276-236020298 CTTTGAAAACAGAGAGAATCTGG - Intronic
948824060 2:240565956-240565978 CTTGGAGAGGAGGGAGGACCTGG + Intronic
1168974911 20:1957494-1957516 CTTTGAAGTCAGAGAGGACCTGG + Intergenic
1169066025 20:2694389-2694411 TTTGGAAGGCAGAGAGTCCCTGG + Intronic
1169216737 20:3798550-3798572 CTGGGAAAGCAGACAGACCATGG + Intronic
1170482363 20:16779085-16779107 CTGAGGAAGCAGAGAGAACTAGG + Intergenic
1170486342 20:16820296-16820318 CTTGGAAAGCTGAGATCACCTGG + Intergenic
1170588692 20:17754806-17754828 CTGGGCAAGCTGAGAGGACCAGG + Intergenic
1171319410 20:24227438-24227460 CTTCGAAAGCAGAAAGCACCAGG + Intergenic
1173139634 20:40470856-40470878 CTGGGAAAGCAGAGACAGGCGGG - Intergenic
1173184765 20:40832080-40832102 CTTGGAGAGCAGACAGAAATGGG + Intergenic
1173288099 20:41691025-41691047 CATGGAAAGGAGAGATACCCAGG - Intergenic
1173409378 20:42796143-42796165 CTTAGAAAGCAGAGACTACAGGG + Intronic
1173583911 20:44167251-44167273 CTTGGAAGGCAAAGACAAGCAGG - Intronic
1173685145 20:44918216-44918238 CTTGGAAGGCTGAGTGAAGCAGG + Intronic
1174686916 20:52465099-52465121 CAGGGAAAGCAGAGACAAGCTGG - Intergenic
1175087445 20:56471648-56471670 CTAGGAAAGAAGAGAGACCCTGG + Intronic
1175556529 20:59863122-59863144 GTTGGAAAGAATAAAGAACCTGG + Intergenic
1175882428 20:62268401-62268423 TGGGGAAAGCAGAGAGCACCAGG - Intronic
1177109404 21:17006532-17006554 ATAGAAAAGAAGAGAGAACCAGG + Intergenic
1178788623 21:35677338-35677360 CCTGGAAACCTGAGAGAAGCAGG + Intronic
1179992456 21:44955235-44955257 CTTGGAAAACAGAGAGAGACAGG + Intronic
1180901658 22:19377363-19377385 ATTAGAAATCAGAAAGAACCAGG - Intronic
1182788913 22:32932495-32932517 CTGGCAAAGCACAGAAAACCAGG + Intronic
1182970082 22:34565643-34565665 CTTGGAAATCAGAAAGACCTGGG - Intergenic
1183040668 22:35175493-35175515 CTTGTAGAGCAAAGAGAAACAGG - Intergenic
1183061752 22:35340449-35340471 CTAGGAAAGCAGGGAGGGCCGGG + Intronic
1183525079 22:38317769-38317791 CCTGGAGAGGAGAGAGATCCTGG - Intronic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1184736241 22:46399304-46399326 CTGGGAGAGCAGTGAGACCCAGG - Intronic
949607821 3:5673832-5673854 CTTGGAAGTCAGAGTGAACTTGG - Intergenic
949862489 3:8518859-8518881 CCTGGAAACCAGAGGAAACCAGG + Intronic
949975346 3:9452567-9452589 CTTGGAAGGAAGAGTGAACAAGG - Intronic
950706827 3:14788064-14788086 CTTGGAAAGCAGAAGGAACTAGG - Intergenic
950794332 3:15498416-15498438 CTTGGAAAGCAGACTGTACTAGG - Intronic
951985984 3:28621525-28621547 CTTTGAAACCAGTGAGAACAAGG + Intergenic
952482781 3:33778810-33778832 ATGGCAAAGCAGAAAGAACCTGG - Intergenic
952735411 3:36686184-36686206 CTTCCAAAACAGAAAGAACCAGG + Intergenic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953855527 3:46496989-46497011 CTTGGAAAGAGGGGAGACCCAGG + Intergenic
954487171 3:50863356-50863378 CTTGTCAAGCACAAAGAACCGGG - Intronic
954600208 3:51861619-51861641 CTTGGGAAGCAGAGAAATCAGGG + Exonic
955112087 3:55959418-55959440 GATGGAGAGCAGAGAGATCCTGG + Intronic
955202830 3:56866473-56866495 CTTGTCCAGCAGGGAGAACCTGG + Intronic
955689786 3:61579597-61579619 CTTGGAAAGCGGCGAAAGCCAGG + Intronic
956180239 3:66510725-66510747 CTTGGAAAGCATAGGTAACCTGG + Intergenic
957206007 3:77199309-77199331 CTTGGAAACCAAGGAGAACCTGG + Intronic
957764966 3:84611946-84611968 CTTGGGAAATAGAGAGATCCAGG + Intergenic
958489490 3:94753708-94753730 ATTGGAAAGTAGGGAGAATCTGG - Intergenic
959568246 3:107854710-107854732 AATGCAAAGCAGAGAGAACAGGG + Intergenic
960813991 3:121654819-121654841 CTTGGAAAGGAGAGGGAAATTGG - Intronic
961235848 3:125366301-125366323 CTTGGTAAGCAAACAGAAGCTGG - Intronic
961942354 3:130651040-130651062 TATGGAAAGCAGAAAGCACCTGG + Intronic
962512585 3:136116559-136116581 AATGGAAAGCAGAAAGAAGCAGG + Intronic
963708488 3:148718514-148718536 CATGGAACGCAGTGAAAACCTGG + Intronic
964225114 3:154389512-154389534 CTTGGAGAGCTGATGGAACCAGG + Intronic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
966875759 3:184320719-184320741 CTCGAAAAGCAGACAGTACCTGG - Exonic
967649406 3:191967519-191967541 TTAGGAAAGCATAGAGAATCAGG - Intergenic
968252920 3:197238244-197238266 CTTGAAAATCACTGAGAACCAGG + Intronic
969853289 4:9979139-9979161 CTTTGAAAGCACACAGACCCGGG + Intronic
971159559 4:24120203-24120225 TTTGGGAAGCAGACAGACCCAGG - Intergenic
971230314 4:24796008-24796030 TTAGGAAAGCAGAGAGGCCCTGG + Intronic
971607586 4:28677871-28677893 CTTGGTAATTAAAGAGAACCTGG - Intergenic
974130299 4:57746549-57746571 AATGGAAAGCAGAAAAAACCAGG - Intergenic
974517625 4:62937370-62937392 CTTTGAAATCAGACAGACCCAGG - Intergenic
974602322 4:64099463-64099485 CTTTGAAAGCAGTAAGAATCAGG - Intergenic
975997788 4:80336256-80336278 TTGGCAAAGCAGAGAGAAACAGG - Intronic
976429728 4:84948471-84948493 CTTGGAGAGCAGAGACAGGCTGG - Intronic
976518517 4:85999830-85999852 CTTGGGAAGCAGTGAGAATTGGG + Intronic
976890964 4:90047289-90047311 CTTGGAATGCAGAGAAATTCTGG - Intergenic
977374614 4:96185636-96185658 CTTGGAAAGAAAAATGAACCTGG - Intergenic
977532238 4:98214063-98214085 CTTAGAAAGCAGAGAGGCTCAGG - Intergenic
977933256 4:102772058-102772080 CTTGCAAAACAGAAAGCACCAGG + Intergenic
979412491 4:120395933-120395955 CTTTGAAAGCAGCCAGAAGCCGG - Intergenic
980732975 4:136846718-136846740 AATGGAAAGCAAAGAGAAGCAGG - Intergenic
980773610 4:137411151-137411173 ATTGAGAAGCAGAGAGAACTTGG - Intergenic
982701340 4:158661949-158661971 CCTGGAAGGCAAAGAGAAACTGG - Intergenic
983271269 4:165564755-165564777 CTAGAAAAGCAGAGAGAAATTGG - Intergenic
984141601 4:176010991-176011013 TTTGGAGTGCAGAGAGATCCAGG + Intergenic
984645188 4:182211151-182211173 CCTGGAAAGAGGAAAGAACCAGG + Intronic
986053026 5:4108099-4108121 CATAGAAAGCAGAAAGAACATGG + Intergenic
986872555 5:12067291-12067313 CTTGGAAGGAAGAGAGAAGAGGG + Intergenic
987117426 5:14736787-14736809 CTTGGCAAGCAGAGCCAGCCAGG - Intronic
988846733 5:35135245-35135267 GAAGGAATGCAGAGAGAACCAGG + Intronic
990859288 5:60308743-60308765 CTTGGAACCCAGAGAAAAACTGG - Intronic
991294173 5:65063202-65063224 CTAGGTAAGCAGAGAGATGCTGG - Intergenic
992304600 5:75423163-75423185 GTTGGAATGCAGTGATAACCAGG - Intronic
992747685 5:79835425-79835447 CTTGTTAAGCACAGAGCACCGGG + Intergenic
993135149 5:83951627-83951649 CATGGAAACCAAAGAGAATCTGG - Intronic
993135773 5:83960907-83960929 CTTGAAAAGCAGAGATAGACTGG + Intronic
994107595 5:95963616-95963638 TTTGGAAAGCGGAGAAAACTAGG - Intergenic
995496265 5:112747776-112747798 GTTGGAAAGAACAGAGAACTAGG - Intronic
995936675 5:117524459-117524481 CTTTGAAAATGGAGAGAACCTGG - Intergenic
996338784 5:122413303-122413325 TTTCTAAAGCAGAGAGAATCTGG - Intronic
997984298 5:138491209-138491231 CTGTGAAGGCAGAAAGAACCTGG - Intergenic
998251576 5:140557181-140557203 CTTGGTAAGCAGCGAGCGCCTGG + Exonic
998254163 5:140572050-140572072 CTTGGAAATCAGACAGATCAGGG + Intronic
1000309978 5:160033022-160033044 CTTAGAAAGCAGGTAGAACTTGG - Intronic
1000332076 5:160213527-160213549 CTTGGAAAACAGACAGAGACAGG - Intronic
1000520050 5:162284069-162284091 TTTGGAGAGCAGAGAGCACCTGG - Intergenic
1000697183 5:164401505-164401527 ATGGGAAAACATAGAGAACCAGG - Intergenic
1000918265 5:167108054-167108076 CAACGAAAGCAGAGAGAACGAGG - Intergenic
1003394884 6:5744539-5744561 CTTGGGAATCAGACAGAACTGGG - Intronic
1004159667 6:13202335-13202357 CTTGGTCAGGAGAAAGAACCAGG - Intronic
1004355057 6:14923433-14923455 TTTGGAAAGAAGAGAGGAGCTGG - Intergenic
1004637759 6:17485441-17485463 CTTGGTAACCAGTGAGAATCAGG + Intronic
1005055669 6:21726645-21726667 CATGGAAAGCAGGCAGAGCCTGG - Intergenic
1006016580 6:31086047-31086069 CTTTAAAAGCTGAGAGAAACGGG + Intergenic
1007154410 6:39728532-39728554 ATTGAGAAGAAGAGAGAACCAGG + Intergenic
1007173193 6:39878813-39878835 CTTGGACAGCAGAGTGCAGCTGG + Intronic
1008047720 6:46868417-46868439 CTTTGAAAGCAAAGAGAAATTGG - Intronic
1009706928 6:67264421-67264443 AATGGAAAGCAGAAAGAAGCAGG - Intergenic
1010457606 6:76076308-76076330 CTTTGAAAGTAGAGAGATCTTGG - Intergenic
1012184942 6:96201671-96201693 CTTGGAATACAGAGAAAATCAGG - Intronic
1013481193 6:110554197-110554219 CTTTGAAAGCAGTGAGTGCCTGG + Intergenic
1013688530 6:112613132-112613154 ATTCAAAAGCAGAGAGAACTCGG - Intergenic
1014225451 6:118841445-118841467 CCTGGAAAGCAGAGGCAAACAGG + Intronic
1014388715 6:120833864-120833886 TCTGGAAAGCAGAGAAAACCAGG - Intergenic
1015256453 6:131184068-131184090 CATGGAGAGCAGAGAGAAACTGG + Intronic
1015507381 6:134003255-134003277 CTAGAAAAGCAGAGAGAGACAGG - Intronic
1015911202 6:138169171-138169193 GAAGGAAAGCAAAGAGAACCAGG - Intronic
1016252880 6:142067941-142067963 TTTGCAAAGCAGAAAGAGCCTGG - Intronic
1016339437 6:143046279-143046301 CTTCTAAAACAGAGGGAACCAGG + Intergenic
1016578494 6:145600315-145600337 GTTGGAAATAAGAGAGAACTAGG - Intronic
1016842712 6:148540528-148540550 CTACGAAAGCAGTGAGAACCTGG + Exonic
1017727864 6:157288011-157288033 CTTGGAAAGACAGGAGAACCTGG + Intergenic
1018730916 6:166649805-166649827 CTTGGAAAGCACAGAGAACCTGG + Intronic
1018754579 6:166837801-166837823 CTTAGAACGCAGTGACAACCTGG - Intronic
1019906692 7:4070289-4070311 CCTGGAAACCAAAGTGAACCGGG - Intronic
1021341373 7:19466610-19466632 CCTGAAAAGCAGAGAGATACAGG - Intergenic
1021504944 7:21371868-21371890 CATTGCAAGGAGAGAGAACCGGG - Intergenic
1021520449 7:21534890-21534912 AGTGGAAAGCAGAGAAAAGCAGG - Intergenic
1021896419 7:25240204-25240226 CTGGCACAGAAGAGAGAACCAGG + Intergenic
1023081598 7:36531985-36532007 CTTGAGGAGCCGAGAGAACCTGG - Intronic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1023487271 7:40700470-40700492 CTTGGAAACCAGAAAGAAATAGG + Intronic
1025242199 7:57286341-57286363 CTTGGAAAGCAGAGAAAAGCTGG - Intergenic
1026167010 7:67919083-67919105 CTTGGAAAGCAGAGAAAAGCTGG - Intergenic
1026212658 7:68319517-68319539 CTTAGAAAACAGAGAGAAGGAGG + Intergenic
1027602586 7:80257353-80257375 CTTGCTAAACACAGAGAACCTGG - Intergenic
1027858175 7:83539597-83539619 TTTGGAAAGCTGAAAGAAACTGG - Intronic
1028644384 7:93078680-93078702 ATTGGAAAGAAGAAAGAAGCAGG + Intergenic
1029381582 7:100218902-100218924 TTTGGATGGCAGAGAGAAACAGG + Intronic
1029401018 7:100346229-100346251 TTTGGATGGCAGAGAGAAACAGG + Intronic
1030029989 7:105360204-105360226 AATGGAAAGCAGAGAAAAGCAGG - Intronic
1030089360 7:105843681-105843703 ATTGAAAAGAAGAGGGAACCTGG - Intronic
1030833867 7:114258874-114258896 CATGGTAGGCAGAGAAAACCTGG + Intronic
1032736377 7:134696238-134696260 CTTGGGGAGCAGTGAAAACCTGG - Intergenic
1032914779 7:136477663-136477685 CTTGGGAAGCAGAGAGCCCAGGG - Intergenic
1034035386 7:147815000-147815022 GTTAGAAAGAAGAGAGCACCAGG + Intronic
1034427190 7:151020259-151020281 CTGGGAAAGCTGAGTGAAACTGG - Intronic
1034697488 7:153066759-153066781 CACTGAGAGCAGAGAGAACCTGG + Intergenic
1034753714 7:153594640-153594662 CTTGGAAAATATAGAGTACCAGG - Intergenic
1034841703 7:154403560-154403582 CTGGGAAAGCAAAGAGCACTGGG + Intronic
1035871328 8:3138906-3138928 TTTGGAAAGAAGAGAGAAGTTGG + Intronic
1036114503 8:5944082-5944104 CTTTGAAAGCAGGAAGAACTGGG - Intergenic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1038022612 8:23562823-23562845 CTTTGGAATCAGAGAGAACTGGG - Intronic
1038179516 8:25213269-25213291 TTTGGACATCAGAGAGACCCCGG - Intronic
1038380381 8:27087285-27087307 CTACCAAAGGAGAGAGAACCTGG + Intergenic
1038428432 8:27480631-27480653 CTTGGAGAGCAGGGAGAAGAGGG + Intergenic
1038839635 8:31171140-31171162 CTTTGAAACCAGGCAGAACCAGG - Intronic
1038946677 8:32369225-32369247 ATAGGAAAGGAGAGAGAACGTGG - Intronic
1040410302 8:47147343-47147365 CCTGGACAGAATAGAGAACCTGG + Intergenic
1041193751 8:55379643-55379665 CAAGGAGAGCAGATAGAACCAGG + Intronic
1041224594 8:55685800-55685822 CTTGGGAAATAGAGAGAAGCAGG + Intergenic
1043357439 8:79429535-79429557 CTTATAATGCAGAGATAACCAGG + Intergenic
1044065068 8:87688827-87688849 CTTGGAAATCTGAGAGAAAGAGG - Intergenic
1044215384 8:89603424-89603446 CTGGGAAAGCTGAGAAAGCCTGG + Intergenic
1044508343 8:93047329-93047351 CATGGAAAGCAGAAAAAAGCAGG - Intergenic
1046819053 8:118616677-118616699 GCTGGAGAGCAGAGAGAACATGG - Intronic
1047692490 8:127370697-127370719 CTTTGAAAGCAGACAAAACTGGG - Intergenic
1047801921 8:128318923-128318945 CTGGGAAGGGAGAGGGAACCAGG + Intergenic
1047924877 8:129672893-129672915 CTGAGAAAGCAGAGAGAACAAGG - Intergenic
1048386145 8:133914191-133914213 GTTGGGAAGCAGAGAGAGCCAGG - Intergenic
1049056595 8:140241897-140241919 CTGGGAAAGGAGAGAGCACACGG + Intronic
1049315048 8:141961444-141961466 CTTAGAAGGCACAGAGAACGTGG + Intergenic
1050069165 9:1792247-1792269 CTGGGAATGCAGAGAAAAGCAGG - Intergenic
1050693282 9:8252342-8252364 GATGGCAAGAAGAGAGAACCAGG - Intergenic
1051055300 9:12978188-12978210 CTTGGAAGGTAGAGAGAAGAGGG - Intergenic
1051778293 9:20659783-20659805 ATTGGAAAGCAGTGAGATGCAGG + Intronic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052937675 9:34106495-34106517 CTTGGAGAGCAGGGAGTAACAGG + Intronic
1055164260 9:73172291-73172313 GTGGGAAATCAGAGGGAACCTGG + Intergenic
1055809573 9:80136789-80136811 ATTCCAAAGCAGAGAGAACAGGG - Intergenic
1055871547 9:80886555-80886577 CAAGGTAACCAGAGAGAACCTGG + Intergenic
1056167926 9:83956686-83956708 TTAGGAAACCAGAGAGACCCCGG + Exonic
1057039843 9:91840092-91840114 CTGGCAGAGCAGAGAGTACCTGG + Intronic
1057698260 9:97342680-97342702 ATTGAGAAGGAGAGAGAACCAGG - Intronic
1058094929 9:100848883-100848905 CATGGAAAGCAGTAAAAACCTGG + Intergenic
1058435702 9:104961130-104961152 CTTGGAAATCAGAAATGACCAGG + Intergenic
1060320004 9:122549690-122549712 AATGGAAAGAATAGAGAACCTGG - Intergenic
1060936131 9:127517268-127517290 GTGGGAATGCAGAGAGAAACAGG - Intronic
1062133150 9:134911074-134911096 CTTGGAAAGCAGAGAGAACCTGG - Intronic
1062286953 9:135777632-135777654 TTAGGAAAGCTGAGAGGACCAGG - Intronic
1185526080 X:781364-781386 CTTGTAAAGGAGGGAGAGCCTGG - Intergenic
1185598781 X:1325005-1325027 CTTTAAAAGAAGAGAGAACCTGG - Intergenic
1187115774 X:16348928-16348950 AAGGGAAAGCACAGAGAACCTGG - Intergenic
1187797317 X:23018180-23018202 CTTTGAAAGCAGAAAGATCTGGG + Intergenic
1188009157 X:25039425-25039447 GTTGGAAAGCAGTGAGTAGCCGG + Intergenic
1189163215 X:38832487-38832509 CTTTAAAATCAGAGAGACCCTGG + Intergenic
1189238196 X:39505160-39505182 TTAGCAAAGCAGACAGAACCCGG - Intergenic
1190061107 X:47212296-47212318 TTTGGAAAGGAGAGACATCCTGG - Intronic
1190850492 X:54235620-54235642 TTTGTAAAGCAGGGAGAACCAGG - Intronic
1191147138 X:57178716-57178738 CATGGGAAGCAGAGAGTAGCAGG + Intergenic
1191756058 X:64593825-64593847 TTTGGAAAGTAGAGACAACTTGG - Intergenic
1192432520 X:71121989-71122011 CTTGGAAGGGAGAGAGAGGCTGG - Intronic
1192960559 X:76126609-76126631 CATGGAGAGCAAAGAGAAGCAGG + Intergenic
1193738463 X:85188224-85188246 CATGGAAAGTAGAAAGAAACAGG - Intergenic
1193949608 X:87781354-87781376 CTTTGAAACCAAAGAGAACGAGG + Intergenic
1194073848 X:89363478-89363500 CCTGGAAAGCAGAAATAAGCTGG - Intergenic
1194908031 X:99603543-99603565 CTTGGATAGCAAAGACAATCTGG + Intergenic
1196059821 X:111395915-111395937 TTGGGAAAGCAGAGATAACAGGG + Intronic
1197130222 X:122996879-122996901 CTTGGAAAGGAGAGAAAGGCAGG - Intergenic
1197166106 X:123379385-123379407 ATTCGAAAGCAAAGAGGACCAGG + Intronic
1197639228 X:128949907-128949929 CCTGGAAGGCTGAGAGAACAAGG - Intergenic
1198323767 X:135546114-135546136 CTTGGAAAGCAGAGTGAGAGAGG + Intronic
1198452292 X:136778986-136779008 CTTGAAAAGCTGAGAGAACTTGG - Intronic
1198567875 X:137923606-137923628 ATAGGAAGGCTGAGAGAACCAGG + Intergenic
1198801635 X:140453695-140453717 CTTGTTTATCAGAGAGAACCAGG - Intergenic
1199132692 X:144211181-144211203 CTTTTAAATCAGAGATAACCTGG - Intergenic
1200729233 Y:6715032-6715054 CCTGGAAAGCAGAAATAAGCTGG - Intergenic
1201305550 Y:12546943-12546965 CTTGGAAAACAGACAGCATCTGG - Intergenic
1201487762 Y:14510289-14510311 CCTTGAAAGCAAAGAGAAACTGG - Intergenic