ID: 1062137198

View in Genome Browser
Species Human (GRCh38)
Location 9:134935510-134935532
Sequence GTTTTTCCCGGGTTTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062137198_1062137207 3 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137207 9:134935536-134935558 CTGGGAAGCAGGGTCGGTTTTGG No data
1062137198_1062137204 -8 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137204 9:134935525-134935547 GGAAAAACAAACTGGGAAGCAGG No data
1062137198_1062137209 10 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137209 9:134935543-134935565 GCAGGGTCGGTTTTGGAGAAGGG No data
1062137198_1062137205 -7 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137205 9:134935526-134935548 GAAAAACAAACTGGGAAGCAGGG No data
1062137198_1062137208 9 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137208 9:134935542-134935564 AGCAGGGTCGGTTTTGGAGAAGG No data
1062137198_1062137206 -3 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137206 9:134935530-134935552 AACAAACTGGGAAGCAGGGTCGG No data
1062137198_1062137211 29 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137211 9:134935562-134935584 AGGGGCAATTGCTGTTTTTTTGG No data
1062137198_1062137210 11 Left 1062137198 9:134935510-134935532 CCTTCCACAAACCCGGGAAAAAC No data
Right 1062137210 9:134935544-134935566 CAGGGTCGGTTTTGGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062137198 Original CRISPR GTTTTTCCCGGGTTTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr