ID: 1062138313

View in Genome Browser
Species Human (GRCh38)
Location 9:134941535-134941557
Sequence TCAGACAAGCAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062138311_1062138313 -1 Left 1062138311 9:134941513-134941535 CCTTAACAGATACTAAAGAACGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG 0: 1
1: 0
2: 5
3: 36
4: 360
1062138309_1062138313 8 Left 1062138309 9:134941504-134941526 CCCTACAAGCCTTAACAGATACT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG 0: 1
1: 0
2: 5
3: 36
4: 360
1062138310_1062138313 7 Left 1062138310 9:134941505-134941527 CCTACAAGCCTTAACAGATACTA 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG 0: 1
1: 0
2: 5
3: 36
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062138313 Original CRISPR TCAGACAAGCAGAATGAGGA TGG Intergenic
900424722 1:2571228-2571250 TCAGAGAAACAGAAAGAGGCAGG + Intergenic
900900175 1:5510705-5510727 GCAGATGAGCAGACTGAGGAAGG + Intergenic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
901267420 1:7922364-7922386 TCAGAAAGGCAGAGAGAGGAAGG + Intronic
902030772 1:13420570-13420592 TCAGACAATCAGAATGACCCTGG + Intronic
902844722 1:19100888-19100910 TGAGACCAGCAGGAGGAGGAAGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
905027623 1:34861715-34861737 TCAGAAAAGAAGACTGAGGAAGG - Intergenic
906612792 1:47214827-47214849 TGAGAGGAGCAGTATGAGGAAGG - Intergenic
907753707 1:57288698-57288720 TAAGACAAGATGAATGATGAAGG + Intronic
908578320 1:65485833-65485855 ACATCCAAGAAGAATGAGGATGG + Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909604958 1:77498736-77498758 TGAGAAAAGGAGGATGAGGATGG + Intronic
910720895 1:90285221-90285243 TCACAGAAGCAGAATTTGGAGGG + Intergenic
911272054 1:95814238-95814260 TCAGACTATCAGAAAGAGTATGG - Intergenic
912488540 1:110048189-110048211 TGAGACACCCAGGATGAGGAGGG + Intronic
912782353 1:112563002-112563024 TCAGAGAAGTAGAATTGGGAGGG + Intronic
913175060 1:116266033-116266055 GCAGATAAGAAGGATGAGGAAGG + Intergenic
913416471 1:118614532-118614554 TCACACAAGCAGGATGACGCTGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915298563 1:154939015-154939037 TCAGAAAATGAGAATGAGGCTGG - Intergenic
916741958 1:167653995-167654017 TCAGAGAAGCAAAATGACAAAGG - Intronic
916819241 1:168381967-168381989 TCAGAAAAGCATCTTGAGGAAGG - Intergenic
917466101 1:175277601-175277623 TCAGATAACCAAAATCAGGAGGG - Intergenic
918534649 1:185560765-185560787 TCAGACAAGAATAAAGAGGAAGG + Intergenic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
918739462 1:188108640-188108662 TGAAACAAGAAGACTGAGGATGG - Intergenic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
919043462 1:192422385-192422407 GCAGACAAGCAAACTGAGGTTGG - Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919555232 1:199044634-199044656 ACACACAAGCAGAATGATGTAGG + Intergenic
919797715 1:201331390-201331412 TCAGACCAGCAGCAGCAGGAGGG + Exonic
919944784 1:202311112-202311134 GAACACAAGCAGAATTAGGAGGG + Intronic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
922041944 1:221905265-221905287 GGAGACAAGAAGAATGAGGGTGG - Intergenic
922961106 1:229646213-229646235 TCAGACAGGCAGTAAGAAGAGGG + Intronic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924031029 1:239885866-239885888 TCAGACAAGGAGAATGACCTAGG - Intronic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1065421175 10:25546082-25546104 TGAGACATGCAGGATGAGGCAGG + Intronic
1066300284 10:34090054-34090076 TCAGGCAAGCAGAATGACTGGGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067498720 10:46783044-46783066 TCAGACATTCAGTATGGGGAAGG + Intergenic
1067595931 10:47557348-47557370 TCAGACATTCAGCATGGGGAAGG - Intergenic
1068897213 10:62219177-62219199 GGAGACAGGCAGAATGAGAATGG + Intronic
1069469821 10:68677976-68677998 TCACCCAGGCAGAGTGAGGAGGG + Intronic
1069839613 10:71331211-71331233 TAAGCCATGCAGGATGAGGATGG + Intronic
1069885740 10:71622496-71622518 TCAGACTAGCAGAAGGGGGCGGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1073703514 10:105956816-105956838 TGAGAAAAGCAGAATGACCAAGG - Intergenic
1073877333 10:107940418-107940440 TGAGACAAGAACAATGGGGAAGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1076498445 10:130915005-130915027 TCAATCTAGCAGCATGAGGAGGG - Intergenic
1077786081 11:5384752-5384774 TAAAATAAGCAGATTGAGGATGG - Intronic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1079779045 11:24575254-24575276 TAAGAAAAGCAGAATTAGAAAGG - Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1085697220 11:78715283-78715305 TCAGAAAAGCAGAAAGATCAAGG - Intronic
1086008363 11:82067909-82067931 TCAGACAAGCAAAATGCTAAGGG - Intergenic
1086582786 11:88418473-88418495 TCAAACAAGCATGGTGAGGATGG + Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1090717216 11:129441138-129441160 TGGGACAAGTAGAATGAGAAAGG - Intronic
1091214585 11:133892966-133892988 TCAGAGGAGCAGTGTGAGGAGGG - Intergenic
1091328912 11:134715038-134715060 TCAGATCAGCAGAATGGAGAGGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091877663 12:3949633-3949655 TCAGAAAACAAGAATTAGGAAGG - Intergenic
1092032518 12:5299615-5299637 TAAGACATGCAGAATGAGAGAGG + Intergenic
1093295369 12:17383528-17383550 TCACACTAGCAGGATGAGGGTGG - Intergenic
1093396918 12:18693877-18693899 TCACACAAGCAGGATGACGCTGG + Intronic
1094631985 12:32184661-32184683 TCAGAAAAACAAAGTGAGGATGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095621754 12:44264513-44264535 TCAGATAAGAAGAATGTTGATGG + Intronic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097484543 12:60179115-60179137 TCAAACTAGCAGAATAAAGAAGG - Intergenic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1099920779 12:88954514-88954536 TCAGACACTCAGAATGAAGTGGG - Intergenic
1100565967 12:95793882-95793904 TAAGACATTCAGAATCAGGAGGG + Intergenic
1102687009 12:114732593-114732615 TCAGCCAACCAGGATGAGGGAGG - Intergenic
1103003983 12:117407268-117407290 ACAGAAAAGCAGAATGATCAGGG - Intronic
1103147171 12:118604888-118604910 ACAGACAAGGAGACTGAGGCTGG - Intergenic
1103940754 12:124500073-124500095 TCAGCCATGCAGAGTCAGGAGGG + Intronic
1106469900 13:30045036-30045058 TCATCCCAGCAGAATGTGGAGGG - Intergenic
1106506682 13:30376562-30376584 TGAGACTAGCAGGTTGAGGAAGG + Intergenic
1106638371 13:31556323-31556345 TCAGACATGCAGACTGAGCAAGG - Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107965954 13:45598488-45598510 TCAGACAGCCAGAAAGAGGCAGG - Intronic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1110034778 13:70669347-70669369 TGAGACAAGGGGAAGGAGGAAGG - Intergenic
1110382582 13:74871294-74871316 TAAGACAAGGAGTATAAGGAGGG + Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1112141827 13:96652446-96652468 GCAGACAAACAGAAGGAAGAAGG - Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113608304 13:111625983-111626005 TCAGAATAGCAGTATGAGGTGGG + Exonic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114748780 14:25180754-25180776 GAAGACAAACAGAATGATGAGGG + Intergenic
1115367488 14:32574795-32574817 TCAGAAAAGCAGAATTTAGATGG - Intronic
1115692889 14:35863889-35863911 TCAGTCAAGAAAAAAGAGGAAGG + Exonic
1115712720 14:36068532-36068554 TCAGAGAAGCAGGCTGAGAAAGG + Intergenic
1115713209 14:36073124-36073146 ACACCCAAGCAGGATGAGGAAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116983681 14:51196873-51196895 TGAGACAGGCAGAATAGGGAAGG - Intergenic
1120978447 14:90270265-90270287 TCACACAAGCAGGATGACGCTGG + Exonic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1124155887 15:27225023-27225045 TCAGAGCAACAGAATGAGGTGGG - Intronic
1125646485 15:41276979-41277001 TGAGGTAAGAAGAATGAGGAAGG + Intronic
1125767523 15:42145495-42145517 AGAGACAAGAAGAATGAGGGAGG - Intronic
1126167019 15:45662453-45662475 TCAGAAAAAGAGAAGGAGGAAGG - Intronic
1126376454 15:48001718-48001740 TCAGACATGCAGAAAGAAGGAGG + Intergenic
1126703505 15:51387160-51387182 TCAGCAAAGGAGACTGAGGAGGG + Intronic
1126903799 15:53342956-53342978 CCAGGGAAGCAGAATTAGGAAGG + Intergenic
1127581481 15:60342728-60342750 CCAGCCAAGCAGAATGACAAGGG - Intergenic
1127686985 15:61355797-61355819 TCAGACAAGATGAATGAAGAAGG - Intergenic
1128025133 15:64429371-64429393 TCAGAAAACAAGAATGAGGCTGG - Intronic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1131296540 15:91154427-91154449 TTAGACAGGCAGATTGTGGAAGG + Intronic
1131426438 15:92348924-92348946 TCAGACAGGCAGAAGCAGGTGGG - Intergenic
1131646316 15:94348964-94348986 ACAGACAAGCAGATAGAGGTAGG - Intronic
1133641795 16:7724262-7724284 CCAGACAAACATAAGGAGGAAGG - Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1136526939 16:30837257-30837279 TGAGACAAGAAAAATCAGGATGG + Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137345131 16:47650522-47650544 TCTGTCAAACAGAATGAGGTAGG - Exonic
1137427301 16:48390547-48390569 TAAGACACGATGAATGAGGAAGG - Intronic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138562565 16:57810622-57810644 CCAGACAACCAGAATGTGCAGGG + Intronic
1138785891 16:59845968-59845990 TGAGAGAAGCAGAATGAAAAAGG - Intergenic
1139595856 16:67957907-67957929 GCAGATAAGCACGATGAGGAGGG + Exonic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140838305 16:78815801-78815823 GCAGCCAAGCAGCAAGAGGAGGG - Intronic
1141072458 16:80969963-80969985 TCAGACAACCAAAATGACTAGGG + Exonic
1141861137 16:86717196-86717218 TCAAAACAGCAGGATGAGGAAGG + Intergenic
1142858334 17:2745911-2745933 TCAGAGAACCAGAAGAAGGAGGG - Intergenic
1143112717 17:4561311-4561333 TCTGACAAGCATAAGGACGAGGG + Intergenic
1143374390 17:6458705-6458727 TCACTCAGGCAGGATGAGGAAGG - Intronic
1144460292 17:15453087-15453109 TGAGAAACACAGAATGAGGAAGG + Intronic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1146396790 17:32474279-32474301 TGAGCCACCCAGAATGAGGAAGG + Intronic
1146543174 17:33715446-33715468 TGAGACAAGCACAAAGAGGATGG + Intronic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147493020 17:40888694-40888716 TCAGACAGGGAGAAGGAGGGTGG + Intergenic
1148427176 17:47608857-47608879 TAAGTCAAACAGAATGATGAAGG + Intronic
1149947364 17:60944934-60944956 TGAGGCAAGCAGAAATAGGAAGG - Intronic
1151255551 17:72873728-72873750 TCAGACCAGCTAAAGGAGGAAGG - Intronic
1151494751 17:74452787-74452809 TCAGATGAGAAGACTGAGGAAGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151898175 17:76994429-76994451 CCAGACAAACGGATTGAGGAAGG + Intergenic
1151913660 17:77101710-77101732 TCAGACCAGCAGTATCAGCATGG - Intronic
1153062515 18:1008507-1008529 AAATACAAGCAAAATGAGGAGGG - Intergenic
1153485879 18:5597225-5597247 TCTGAGAAGCAGAATGACTAAGG - Intronic
1155751068 18:29422834-29422856 TTAGGCAAGCAGCATTAGGATGG - Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1156046150 18:32879733-32879755 TCATTCAAGCAGAAGGAGGGTGG + Intergenic
1157218188 18:45802690-45802712 TCAGTCATGCAGAGTGAGGGTGG - Intergenic
1159559840 18:69982292-69982314 TCAGTCAAGCAGTATGCTGAAGG + Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1163193422 19:15696695-15696717 TCAGACCAGCAGATGGAGAAGGG - Intronic
1163200082 19:15760611-15760633 TCAGACCAGCAGATGGAGGAGGG + Intergenic
1163597658 19:18229728-18229750 GGAGTCAAGCAGAATGAGCAGGG + Intronic
1163785041 19:19270609-19270631 TCAGACATGCAGAATGAGGCAGG - Intronic
1164814491 19:31184882-31184904 TCAGCAGAGCAGAATGAGAAGGG + Intergenic
1165290341 19:34878913-34878935 TTAGAAAAGCAGAATCAGGCAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167649809 19:50723139-50723161 TCAGATAATCAGGAAGAGGATGG - Intergenic
1168157459 19:54483711-54483733 TCAGTCATGCAAGATGAGGAAGG - Intergenic
1168158032 19:54488573-54488595 TCAGTCATGCAAGATGAGGAAGG - Intergenic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
928251800 2:29687277-29687299 TAAGCCAAGCAGAAAGAGGTAGG + Intronic
930694848 2:54400980-54401002 TCAGAGAAGCAGAATCACTAGGG - Intergenic
931220812 2:60286329-60286351 TCTGACAAGCGGAATTGGGAAGG - Intergenic
931553647 2:63475308-63475330 TTAGGCAAGCAGAAAGAGAAAGG - Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932569311 2:72929885-72929907 TGAGTCAGGCAGAATGAAGAAGG - Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933470306 2:82714570-82714592 TCAGACAAACACAAAGAAGATGG - Intergenic
933524876 2:83424016-83424038 TCACAAAAGCAAAATGATGAGGG - Intergenic
934165908 2:89294119-89294141 TCAGAAAAGCAGGAGGAAGAGGG + Intergenic
934201369 2:89888337-89888359 TCAGAAAAGCAGGAGGAAGAGGG - Intergenic
934885467 2:98020807-98020829 ACAGACACGCAGAAAGAAGATGG - Intergenic
935875515 2:107502594-107502616 CCAGACAAGGAGAATGACAATGG - Intergenic
935929914 2:108113256-108113278 TCAGACAGTCTGAATGAGGAAGG - Intergenic
936232113 2:110712168-110712190 CCAGACCAGCAGGGTGAGGAGGG - Intergenic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
939675735 2:145069841-145069863 TCTGGCAAGCAGAATAAGCATGG + Intergenic
940172980 2:150848862-150848884 TCTGACAGGCAGAATGAGAGAGG + Intergenic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
942998146 2:182290552-182290574 TCAGGCAAGCAGAGGGAGGCTGG - Intronic
943513197 2:188851981-188852003 TAAGACAAGGAGAATGAGAGCGG - Intergenic
943644122 2:190389832-190389854 TCAATCAAGCTGAGTGAGGATGG + Intergenic
944145549 2:196503669-196503691 ACAGCCCAGCAGAATCAGGAGGG + Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
945766568 2:213987286-213987308 TGAGAAAGGCAGAATGAGGTAGG - Intronic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
947140989 2:227019162-227019184 TCAGACCAATAGAATGTGGAAGG - Intronic
947157259 2:227175048-227175070 TCAGGGAAGCAGACTGAGGCTGG + Intronic
948908381 2:240990889-240990911 TCAGGCACTCAGAATGAGGCTGG - Intronic
949066528 2:241994056-241994078 TCAGACAGGAAGAGTGAGGATGG + Intergenic
1168831955 20:850526-850548 TCATACAGCCAGAAAGAGGAAGG - Intronic
1168987903 20:2066154-2066176 CCAGACAGGGAGAATGGGGAAGG + Intergenic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1170365770 20:15597041-15597063 TCAGACTAACAGTATGAGGAAGG - Intronic
1170578124 20:17680213-17680235 TCAAACAAGGAGTGTGAGGAGGG + Intronic
1171370190 20:24657406-24657428 TCAGACCAGCAGGAGGCGGAGGG + Intronic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1173779058 20:45738230-45738252 TCATAGAAGCAGAATTAGAATGG + Intergenic
1174091980 20:48056539-48056561 TCAGATAACTAGAATGTGGAAGG - Intergenic
1174237002 20:49102339-49102361 TCAGACAAGGAGTAAGAGCAAGG - Intergenic
1175706969 20:61186526-61186548 TCATACATGCGGAATGAGGAAGG - Intergenic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1176990036 21:15484817-15484839 TCTCACAAGCAAAGTGAGGAGGG - Intergenic
1177475520 21:21615582-21615604 TCAGAAAAGCAGAAAGAGATGGG + Intergenic
1179176569 21:39012037-39012059 TCAGACAAGAAGAACGAGCAGGG + Intergenic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179537941 21:42064231-42064253 TGAGTCAAGCAGAATGTGGGTGG + Intronic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1183138481 22:35913842-35913864 TAAGAAAAGGGGAATGAGGAAGG + Intronic
1184462442 22:44646870-44646892 TCAGACCAGCAGATGGGGGAGGG + Intergenic
949444161 3:4115433-4115455 TAACACAAGCAGCCTGAGGATGG + Intronic
949754977 3:7398881-7398903 TCAGAGAAGTAGAAAGAGGGAGG - Intronic
950152766 3:10700822-10700844 TCAGAGAACCAGACTGAGGGAGG + Intronic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
952274929 3:31867728-31867750 TAAGACAAGAAGAAAGAGAAAGG + Intronic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953369311 3:42373651-42373673 TAAGACATGCACAATCAGGAAGG + Intergenic
953765812 3:45741170-45741192 TCAGACAGGCAGAGAGAGGTTGG - Intronic
956056460 3:65303801-65303823 TCAGAAAAGCACAAGCAGGAAGG - Intergenic
956378082 3:68636805-68636827 TCACACAAGCAGGATGACGCTGG + Intergenic
956561299 3:70578357-70578379 TCTGACAACCAGAATGACCAGGG + Intergenic
956573871 3:70729665-70729687 CCAGTCCAGCAGAATCAGGAAGG - Intergenic
956576849 3:70761307-70761329 ACAGGCAAGCAGAGTGAGAAGGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956772382 3:72537476-72537498 TCAGACAAACAGAATGCAGATGG - Intergenic
959890582 3:111550731-111550753 TCAGAAAAGAAGATTGAGGAAGG + Intronic
961938958 3:130617438-130617460 GCAGGCATGCAGAAAGAGGATGG + Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
967059498 3:185859508-185859530 TAAGACCTGGAGAATGAGGAAGG - Intergenic
968390475 4:188322-188344 CCAAACAATCCGAATGAGGAAGG - Intergenic
969232448 4:5841200-5841222 TCAGACAGGCAGCCGGAGGAGGG - Intronic
969381363 4:6800712-6800734 TCAAACAAGTATAATGAGCAAGG - Intronic
970573902 4:17408822-17408844 TCAGACAAGGAAAAAGAAGAAGG - Intergenic
970588757 4:17540374-17540396 GGAGACAAGCAGAGTGTGGAAGG + Intergenic
970750930 4:19359977-19359999 CCAGACAAGAAGAGTGAGGAAGG + Intergenic
970941759 4:21642218-21642240 TCAAACCAGCAGCATCAGGATGG - Intronic
971020120 4:22526586-22526608 TGAGCCAAGCAGAATGAGAAGGG + Intergenic
973646339 4:52954605-52954627 TCAGAAAAGCAGCAAGAGAAAGG + Intronic
973779403 4:54274019-54274041 TTAGACAAGCAAAATGTTGAGGG - Intronic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974338469 4:60582765-60582787 GAAGACAAGTAGAATGATGATGG + Intergenic
975119366 4:70711836-70711858 TCACAAAGGCAGAATCAGGAAGG - Intronic
975884142 4:78944168-78944190 TCAGACAAGCTTAATTAGGCAGG - Intergenic
977599193 4:98917665-98917687 TCAGAAAAGAAGATGGAGGAGGG + Intronic
981006570 4:139881194-139881216 TCAGACAAGAAGAAGGCGGGTGG + Intronic
981060970 4:140425408-140425430 TCAGAGAAGCAGAATCAATAGGG + Intronic
981743170 4:148024362-148024384 TGAGATTAGCAGAGTGAGGAAGG + Intronic
981975704 4:150724746-150724768 TAAATCAAGCAGAATGAGTAGGG + Intronic
984624781 4:181994990-181995012 TAAGAAAAGTAGAATGAGGCTGG + Intergenic
984733443 4:183089264-183089286 TAAGACAAGCAGGGTGAAGATGG + Intergenic
985219032 4:187683042-187683064 TCATGCAAGGAGAATGAGGAGGG + Intergenic
986343001 5:6808348-6808370 TCAGCCATGCACATTGAGGAAGG + Intergenic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991234207 5:64375466-64375488 TAAGACAAGTTGACTGAGGAAGG + Intergenic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
992342914 5:75844616-75844638 TCAGACAGGCACAATAAGCATGG + Intergenic
992455672 5:76913447-76913469 TCAGACAAACAGAATCAGGAAGG + Intronic
992795936 5:80255525-80255547 TCCGACAAGCAGAGTGGAGAGGG + Intronic
993225114 5:85159777-85159799 CCAGACAAGCAGAAGCAGTAAGG - Intergenic
994659903 5:102641312-102641334 GCAGACATGCAGCATGAAGACGG + Intergenic
995005918 5:107195176-107195198 TCACACAAGCAGGATGACGCTGG + Intergenic
995152820 5:108869782-108869804 TCAGTCAAGCAGAGTCTGGAAGG - Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
996881350 5:128299950-128299972 TCAGAAAATCAGAATGACTAGGG + Intronic
997155981 5:131558344-131558366 TCATACAATCAGTATCAGGAAGG - Intronic
997423738 5:133788671-133788693 TCACACAAGAACAATGAGCATGG - Intergenic
999127589 5:149257968-149257990 TCAGGCATGCAGAAAGCGGAGGG + Intronic
1000578502 5:163006798-163006820 ACAGACCAGAAGAATGAGGATGG + Intergenic
1000806442 5:165798862-165798884 TCAGACAAACAGAAAGAAAAAGG + Intergenic
1001106179 5:168856568-168856590 TTAGGCAAAGAGAATGAGGACGG + Intronic
1002175242 5:177397910-177397932 GCAGACAAGGAGATAGAGGACGG - Exonic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1003282170 6:4703556-4703578 TCACACAAGCAGGATGATGCTGG + Intergenic
1003624939 6:7732771-7732793 TTAGACAAGGAAAATGAAGAGGG + Intronic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005164349 6:22902482-22902504 TCAAACAACATGAATGAGGAAGG - Intergenic
1005941877 6:30566604-30566626 CCAGACAAGGAGACTAAGGAGGG + Intergenic
1007363941 6:41376771-41376793 TCAGGAAAGCAGCCTGAGGAGGG + Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010027677 6:71238728-71238750 TCAGCCAAGCAGAATGACTCTGG + Intergenic
1010191048 6:73197051-73197073 GCAGCCAAGCAGAATGAGCAGGG + Exonic
1010275566 6:73965015-73965037 TCAGAGATGCAGTATTAGGAAGG + Intergenic
1010302417 6:74277359-74277381 TCAAATAATCAGAATGATGAGGG + Intergenic
1011435955 6:87336960-87336982 TCAGAGAAGCACAATTATGAAGG + Intronic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013570356 6:111417547-111417569 CCAGTGAAGCAGAGTGAGGAGGG - Intronic
1014001110 6:116367578-116367600 TCAGACAAGAAGAACATGGAAGG + Intronic
1015498952 6:133910400-133910422 TCAGCCAAGAAGAATGGAGAAGG + Intergenic
1016474073 6:144407006-144407028 TCAGACAAGCAGGAAGGGGTAGG - Intronic
1016521681 6:144953644-144953666 TCAGAAAAGCTGAGTGAGGTAGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017582450 6:155881238-155881260 TCAGGAAAGTAGAATGTGGAGGG - Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1020382921 7:7566345-7566367 TGAGACAAGAAGGATGAGTATGG - Intergenic
1022115641 7:27258145-27258167 TTAGACTTGCAGGATGAGGAGGG + Intergenic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1024358769 7:48445856-48445878 ACAGACCAGCTGAATGAGAAGGG + Intronic
1024462154 7:49670048-49670070 TCAATCAAGGAGAGTGAGGAAGG + Intergenic
1024513503 7:50221819-50221841 TCAGCCAAGCATAATGAGACTGG + Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1026133958 7:67643130-67643152 TAAAACAGGCAGAATCAGGAAGG - Intergenic
1032480242 7:132240305-132240327 TCAGACAACCAGAAAGCTGAAGG - Intronic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1035087759 7:156275828-156275850 ACAGACCTGAAGAATGAGGAGGG - Intergenic
1035461164 7:159040106-159040128 CCAAACAAGCACACTGAGGAAGG + Intronic
1035713979 8:1739707-1739729 TGAGACAAATAGAGTGAGGATGG - Intergenic
1035824383 8:2629014-2629036 TCACACAAACAGACTGAGGGTGG + Intergenic
1036298491 8:7554629-7554651 TCAGACATCCAGAAAGAAGACGG + Intergenic
1036299796 8:7562279-7562301 TCAGACATCCAGAAAGAAGACGG + Intergenic
1037352552 8:17976724-17976746 TGAGAAAAACAGAATGAGAAAGG + Intronic
1037571839 8:20164690-20164712 TCAGAGAAGCAGTCTGAGAAAGG - Intronic
1038162482 8:25053004-25053026 TTAGCCAGGCAGAATGGGGAAGG - Intergenic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1038699603 8:29837233-29837255 GAAGCCAAGCAGAATGAGGAAGG + Intergenic
1039059900 8:33565252-33565274 TCCGACCAGCAAAAGGAGGAAGG + Intronic
1039080476 8:33728958-33728980 TCAGAAAAGCAGCAAGAAGATGG - Intergenic
1039327092 8:36497450-36497472 TCAGAGAAGAAAAATGAGAAAGG + Intergenic
1042582111 8:70291554-70291576 ACAGACAAGTAGAATGATGTTGG - Intronic
1042701876 8:71624540-71624562 TCAGAGAAGCTGTAGGAGGAAGG - Intergenic
1044362525 8:91304880-91304902 TCATACAAGCAGCATGAGAAGGG - Intronic
1045946109 8:107798098-107798120 TGAGACCAGCATAATGAGAAGGG + Intergenic
1046616859 8:116487197-116487219 TCAGACAAGCAGTTAGAGGGAGG - Intergenic
1046626445 8:116581551-116581573 TAAAACTAGGAGAATGAGGAAGG - Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1048288214 8:133158863-133158885 TGAGACTAGCAGCCTGAGGAGGG + Intergenic
1049665237 8:143840070-143840092 TCACCCAAGCAGGATGAGGAGGG + Intronic
1050368306 9:4894189-4894211 TGAAACACGAAGAATGAGGAAGG - Intergenic
1051068092 9:13129164-13129186 TCAGAAAAGCAGGATGAGGCTGG + Intronic
1051224376 9:14883533-14883555 TCAGACGAGCAGACCGAGAAAGG + Intronic
1051264651 9:15298942-15298964 TGAGTCAAGAAGAATGAGTAGGG - Intronic
1051345084 9:16144149-16144171 TCAGAAAAGCAGAGTGTGGGTGG - Intergenic
1052293234 9:26868126-26868148 TCAGCCTAGCATAATAAGGAAGG - Intronic
1052959402 9:34281930-34281952 TCCCACCAGCAGTATGAGGATGG - Intronic
1053302048 9:36959186-36959208 TAAGATAAGAAGAATGAGAAGGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055585562 9:77755965-77755987 TCAGTCACCCAGACTGAGGAAGG - Intronic
1056440755 9:86618752-86618774 TCAGAAAAGAAAAATAAGGAAGG - Intergenic
1056622344 9:88224810-88224832 TCAAACAGGCAGAAACAGGATGG + Intergenic
1056667612 9:88593513-88593535 GCAGACAAGGGGAATGAGCAAGG + Intergenic
1057517022 9:95730225-95730247 CCAGACACACAGAATCAGGAAGG + Intergenic
1057950888 9:99368388-99368410 TCAGAAGAACAGACTGAGGATGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059108723 9:111534579-111534601 TCAGTGAAGGAAAATGAGGAAGG + Intronic
1059965980 9:119614226-119614248 TCAGATACAGAGAATGAGGAGGG + Intergenic
1061619185 9:131800089-131800111 CCAGACAAGAGGAATGAGGGTGG - Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1186535550 X:10343625-10343647 ACAGACAAGCAGAAAGAACATGG + Intergenic
1187170714 X:16848726-16848748 TCAGACGGGAAGAATGAGGATGG + Intronic
1188085102 X:25894208-25894230 TTAGGCAAGCAGCATGAGAAGGG + Intergenic
1189105674 X:38232914-38232936 TCAAAGAAGCAGAATCAGTAGGG - Intronic
1190338783 X:49280016-49280038 GCAGTCAAGAGGAATGAGGATGG - Intronic
1195850192 X:109274450-109274472 TCTGACAAGAACGATGAGGATGG - Intergenic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196051788 X:111313273-111313295 TCACACATGCAGAATGAGGTAGG - Intronic
1197388024 X:125825129-125825151 TCTGACAAGCAAAATGCTGAGGG - Intergenic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198786170 X:140290902-140290924 TCAGACAAGCATAATGCTGAGGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1200006371 X:153087833-153087855 TCAGACAAGTAGACTGAGAAAGG + Intergenic
1200034486 X:153318981-153319003 TCAGAAAACGAGGATGAGGATGG - Intergenic
1200230860 X:154443294-154443316 TGAGCCAAGCAGAAGGAGGTGGG + Exonic
1201464392 Y:14264476-14264498 TCAGAAAAGAAGAATTGGGATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic