ID: 1062140350

View in Genome Browser
Species Human (GRCh38)
Location 9:134953791-134953813
Sequence ATCAATAGGCCATAGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062140346_1062140350 9 Left 1062140346 9:134953759-134953781 CCTATTGAATGGTCTTGGCACCC 0: 43
1: 180
2: 404
3: 712
4: 1518
Right 1062140350 9:134953791-134953813 ATCAATAGGCCATAGATGTGAGG No data
1062140345_1062140350 10 Left 1062140345 9:134953758-134953780 CCCTATTGAATGGTCTTGGCACC 0: 13
1: 82
2: 258
3: 646
4: 1515
Right 1062140350 9:134953791-134953813 ATCAATAGGCCATAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062140350 Original CRISPR ATCAATAGGCCATAGATGTG AGG Intergenic
No off target data available for this crispr