ID: 1062140533

View in Genome Browser
Species Human (GRCh38)
Location 9:134955424-134955446
Sequence CAGAGCAGAGGGAAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062140527_1062140533 6 Left 1062140527 9:134955395-134955417 CCTGGAGTCTGAGTTCAGGTCCC No data
Right 1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG No data
1062140526_1062140533 7 Left 1062140526 9:134955394-134955416 CCCTGGAGTCTGAGTTCAGGTCC No data
Right 1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG No data
1062140524_1062140533 22 Left 1062140524 9:134955379-134955401 CCATGGCTTAGAGTGCCCTGGAG No data
Right 1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG No data
1062140522_1062140533 30 Left 1062140522 9:134955371-134955393 CCATGCAGCCATGGCTTAGAGTG No data
Right 1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062140533 Original CRISPR CAGAGCAGAGGGAAGGCAGC TGG Intergenic
No off target data available for this crispr