ID: 1062144897

View in Genome Browser
Species Human (GRCh38)
Location 9:134983521-134983543
Sequence ATAAGGACTCTTGTGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062144897_1062144906 10 Left 1062144897 9:134983521-134983543 CCATGAGCCACAAGAGTCCTTAT No data
Right 1062144906 9:134983554-134983576 CAGGAGGGTCCAAGTCAGAAAGG No data
1062144897_1062144902 -9 Left 1062144897 9:134983521-134983543 CCATGAGCCACAAGAGTCCTTAT No data
Right 1062144902 9:134983535-134983557 AGTCCTTATGAGAGGGAGGCAGG No data
1062144897_1062144905 -5 Left 1062144897 9:134983521-134983543 CCATGAGCCACAAGAGTCCTTAT No data
Right 1062144905 9:134983539-134983561 CTTATGAGAGGGAGGCAGGAGGG No data
1062144897_1062144904 -6 Left 1062144897 9:134983521-134983543 CCATGAGCCACAAGAGTCCTTAT No data
Right 1062144904 9:134983538-134983560 CCTTATGAGAGGGAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062144897 Original CRISPR ATAAGGACTCTTGTGGCTCA TGG (reversed) Intergenic
No off target data available for this crispr