ID: 1062146442

View in Genome Browser
Species Human (GRCh38)
Location 9:134992271-134992293
Sequence AAGGACCCCCCTCCCCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062146427_1062146442 25 Left 1062146427 9:134992223-134992245 CCAGGAAGGAGGAAGAGGCCACC No data
Right 1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG No data
1062146433_1062146442 4 Left 1062146433 9:134992244-134992266 CCCCACGGAGGGTCTCCCGGAAG No data
Right 1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG No data
1062146434_1062146442 3 Left 1062146434 9:134992245-134992267 CCCACGGAGGGTCTCCCGGAAGG No data
Right 1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG No data
1062146431_1062146442 7 Left 1062146431 9:134992241-134992263 CCACCCCACGGAGGGTCTCCCGG No data
Right 1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG No data
1062146436_1062146442 2 Left 1062146436 9:134992246-134992268 CCACGGAGGGTCTCCCGGAAGGA No data
Right 1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062146442 Original CRISPR AAGGACCCCCCTCCCCGCGG AGG Intergenic
No off target data available for this crispr