ID: 1062146869

View in Genome Browser
Species Human (GRCh38)
Location 9:134994435-134994457
Sequence GAGTTCATCTCGCAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062146869_1062146876 -5 Left 1062146869 9:134994435-134994457 CCATCACCCTGCGAGATGAACTC No data
Right 1062146876 9:134994453-134994475 AACTCTGGGCTAAAGCAGGAGGG No data
1062146869_1062146882 26 Left 1062146869 9:134994435-134994457 CCATCACCCTGCGAGATGAACTC No data
Right 1062146882 9:134994484-134994506 CCTCACCCTGACAGTCATCCTGG No data
1062146869_1062146883 27 Left 1062146869 9:134994435-134994457 CCATCACCCTGCGAGATGAACTC No data
Right 1062146883 9:134994485-134994507 CTCACCCTGACAGTCATCCTGGG No data
1062146869_1062146884 30 Left 1062146869 9:134994435-134994457 CCATCACCCTGCGAGATGAACTC No data
Right 1062146884 9:134994488-134994510 ACCCTGACAGTCATCCTGGGAGG No data
1062146869_1062146874 -9 Left 1062146869 9:134994435-134994457 CCATCACCCTGCGAGATGAACTC No data
Right 1062146874 9:134994449-134994471 GATGAACTCTGGGCTAAAGCAGG No data
1062146869_1062146875 -6 Left 1062146869 9:134994435-134994457 CCATCACCCTGCGAGATGAACTC No data
Right 1062146875 9:134994452-134994474 GAACTCTGGGCTAAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062146869 Original CRISPR GAGTTCATCTCGCAGGGTGA TGG (reversed) Intergenic
No off target data available for this crispr