ID: 1062149105

View in Genome Browser
Species Human (GRCh38)
Location 9:135008285-135008307
Sequence CTGAATAGACAAATCAAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062149102_1062149105 1 Left 1062149102 9:135008261-135008283 CCTGACATTGAAGGTCTGCTTGC No data
Right 1062149105 9:135008285-135008307 CTGAATAGACAAATCAAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062149105 Original CRISPR CTGAATAGACAAATCAAACC CGG Intergenic
No off target data available for this crispr