ID: 1062149827

View in Genome Browser
Species Human (GRCh38)
Location 9:135012227-135012249
Sequence CTTTGGGTCTGGGAGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062149827_1062149836 16 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149836 9:135012266-135012288 GAACCCAGCTCCTGAAGCGGTGG No data
1062149827_1062149834 -6 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149834 9:135012244-135012266 CCAAAGGCTGACAGCTGAGTAGG No data
1062149827_1062149835 13 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149835 9:135012263-135012285 TAGGAACCCAGCTCCTGAAGCGG No data
1062149827_1062149840 20 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149840 9:135012270-135012292 CCAGCTCCTGAAGCGGTGGGAGG No data
1062149827_1062149841 21 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149841 9:135012271-135012293 CAGCTCCTGAAGCGGTGGGAGGG No data
1062149827_1062149837 17 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149837 9:135012267-135012289 AACCCAGCTCCTGAAGCGGTGGG No data
1062149827_1062149844 29 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149844 9:135012279-135012301 GAAGCGGTGGGAGGGCCAGAGGG No data
1062149827_1062149843 28 Left 1062149827 9:135012227-135012249 CCCTTTGACTCCCAGACCCAAAG No data
Right 1062149843 9:135012278-135012300 TGAAGCGGTGGGAGGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062149827 Original CRISPR CTTTGGGTCTGGGAGTCAAA GGG (reversed) Intergenic
No off target data available for this crispr