ID: 1062153209

View in Genome Browser
Species Human (GRCh38)
Location 9:135032091-135032113
Sequence TTGGATACAAACACCCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062153209_1062153211 -3 Left 1062153209 9:135032091-135032113 CCTTAAAGGGTGTTTGTATCCAA No data
Right 1062153211 9:135032111-135032133 CAAAACTGTGCTTCAGCCACTGG No data
1062153209_1062153213 3 Left 1062153209 9:135032091-135032113 CCTTAAAGGGTGTTTGTATCCAA No data
Right 1062153213 9:135032117-135032139 TGTGCTTCAGCCACTGGCCTGGG No data
1062153209_1062153214 11 Left 1062153209 9:135032091-135032113 CCTTAAAGGGTGTTTGTATCCAA No data
Right 1062153214 9:135032125-135032147 AGCCACTGGCCTGGGCTCGCAGG No data
1062153209_1062153212 2 Left 1062153209 9:135032091-135032113 CCTTAAAGGGTGTTTGTATCCAA No data
Right 1062153212 9:135032116-135032138 CTGTGCTTCAGCCACTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062153209 Original CRISPR TTGGATACAAACACCCTTTA AGG (reversed) Intergenic
No off target data available for this crispr