ID: 1062153853

View in Genome Browser
Species Human (GRCh38)
Location 9:135035122-135035144
Sequence GCAGGATTGCCAGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062153847_1062153853 19 Left 1062153847 9:135035080-135035102 CCTGTCATCCTGCTTTCAATCAT No data
Right 1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG No data
1062153850_1062153853 11 Left 1062153850 9:135035088-135035110 CCTGCTTTCAATCATCTTGGGTA No data
Right 1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062153853 Original CRISPR GCAGGATTGCCAGCCAGGTG CGG Intergenic
No off target data available for this crispr