ID: 1062158133

View in Genome Browser
Species Human (GRCh38)
Location 9:135065468-135065490
Sequence TTCCCCAAGGGGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062158133_1062158138 -6 Left 1062158133 9:135065468-135065490 CCATCCTGCTTCCCCTTGGGGAA No data
Right 1062158138 9:135065485-135065507 GGGGAACCCCTCCAGCCTCATGG No data
1062158133_1062158139 -5 Left 1062158133 9:135065468-135065490 CCATCCTGCTTCCCCTTGGGGAA No data
Right 1062158139 9:135065486-135065508 GGGAACCCCTCCAGCCTCATGGG No data
1062158133_1062158145 14 Left 1062158133 9:135065468-135065490 CCATCCTGCTTCCCCTTGGGGAA No data
Right 1062158145 9:135065505-135065527 TGGGTGCTGTCTGTCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062158133 Original CRISPR TTCCCCAAGGGGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr