ID: 1062159723

View in Genome Browser
Species Human (GRCh38)
Location 9:135073689-135073711
Sequence CTCTGTGAGGAGATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062159723_1062159732 2 Left 1062159723 9:135073689-135073711 CCCAGCACCATCTCCTCACAGAG No data
Right 1062159732 9:135073714-135073736 TTGGGGGCCACCCTGCCTCAGGG No data
1062159723_1062159739 21 Left 1062159723 9:135073689-135073711 CCCAGCACCATCTCCTCACAGAG No data
Right 1062159739 9:135073733-135073755 AGGGGCCGTGGCATATCACCAGG No data
1062159723_1062159733 3 Left 1062159723 9:135073689-135073711 CCCAGCACCATCTCCTCACAGAG No data
Right 1062159733 9:135073715-135073737 TGGGGGCCACCCTGCCTCAGGGG No data
1062159723_1062159735 9 Left 1062159723 9:135073689-135073711 CCCAGCACCATCTCCTCACAGAG No data
Right 1062159735 9:135073721-135073743 CCACCCTGCCTCAGGGGCCGTGG No data
1062159723_1062159731 1 Left 1062159723 9:135073689-135073711 CCCAGCACCATCTCCTCACAGAG No data
Right 1062159731 9:135073713-135073735 CTTGGGGGCCACCCTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062159723 Original CRISPR CTCTGTGAGGAGATGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr