ID: 1062161455

View in Genome Browser
Species Human (GRCh38)
Location 9:135082620-135082642
Sequence GTGTGTGCATATTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062161455_1062161461 -6 Left 1062161455 9:135082620-135082642 CCCAGCCCCAAATATGCACACAC 0: 1
1: 0
2: 3
3: 44
4: 392
Right 1062161461 9:135082637-135082659 ACACACAGGTTTCCGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062161455 Original CRISPR GTGTGTGCATATTTGGGGCT GGG (reversed) Intronic
900601260 1:3503736-3503758 GTGTGTACACGTTTGGGGGTGGG + Intronic
900708360 1:4094598-4094620 GTATGAGCTTATTTGGGGATTGG + Intergenic
901166999 1:7228504-7228526 GTGTGTTCCTAACTGGGGCTGGG - Intronic
901407704 1:9060720-9060742 GTGTGTGCATATGTGTGTGTGGG - Intronic
901712992 1:11130341-11130363 GTGTGTGAATATTTGTGTTTGGG - Intronic
902373066 1:16017400-16017422 GTGTGTGTGTATATGAGGCTAGG + Intronic
903634746 1:24804372-24804394 GTGTGTGCATGTGTGTGGGTGGG + Intronic
903677837 1:25075824-25075846 ATATGTGCACATTTGGGGGTGGG - Intergenic
904362283 1:29984049-29984071 CTGTGTGCTTATTTGGGGGCTGG - Intergenic
904591081 1:31615704-31615726 GAGTGTGCATATGTGGAACTTGG - Intergenic
905352786 1:37359120-37359142 GTGTGTGTGTGTTGGGGGCTGGG + Intergenic
906202390 1:43968356-43968378 GTGTGTGTGTATTGGGGGGTGGG + Intergenic
906919016 1:50043510-50043532 GTATGTGTATATGTGGGGGTGGG - Intergenic
907072484 1:51549280-51549302 GAGTGTGCATCTTTGGGGGAAGG - Intergenic
907372604 1:54012955-54012977 ACGTGTGCATAATTGGGGATGGG + Intronic
907426900 1:54385478-54385500 GTGTGTGTGTGTTTGGGGTTGGG - Intronic
907804666 1:57806289-57806311 ATGTGATCATATTTGGGGATAGG + Intronic
908757178 1:67479674-67479696 ATGTGTGCATTTGAGGGGCTGGG + Intergenic
909047638 1:70729190-70729212 GTGTGTGCTTGTGTGGGCCTGGG - Intergenic
910854948 1:91685693-91685715 GTGTGTGTATAATTAAGGCTGGG + Intronic
912645902 1:111391538-111391560 GTGTGTGAGTATTTGGGGGGTGG - Intergenic
912770089 1:112455772-112455794 GTGTGTGCATTTTTTGTGTTAGG + Intronic
913046592 1:115078467-115078489 GTGTGAGGATATGTGGGGTTGGG + Intronic
915240926 1:154521155-154521177 GTATGTCCAGACTTGGGGCTGGG - Intronic
915470831 1:156124788-156124810 GTATGTGTATATTTGAGGGTGGG + Intronic
916286608 1:163112298-163112320 GTGTTTGGATTTTTGGGGTTAGG - Intronic
916970751 1:170012620-170012642 ATGTGATAATATTTGGGGCTGGG + Intronic
917075155 1:171197396-171197418 GTGTTTGAATCTTTGGGGGTAGG - Intronic
918219498 1:182423454-182423476 TTGTGTGGAGACTTGGGGCTGGG + Intergenic
918446200 1:184619287-184619309 GTAAGGGCTTATTTGGGGCTTGG + Intronic
919038273 1:192345452-192345474 ATGTGTCAATATTTGGGGTTTGG + Intronic
920277371 1:204816676-204816698 GTGTGTGCTTGTGTGGGGGTGGG + Intergenic
921280300 1:213560142-213560164 GTATGTGTATATCAGGGGCTGGG - Intergenic
921737395 1:218643573-218643595 GTGTGTGTGTATTGGGAGCTGGG + Intergenic
923337395 1:232982350-232982372 GTGTGTGCACATCTGTGCCTCGG + Exonic
1064190900 10:13204649-13204671 GTGTGTGTTTGTTGGGGGCTAGG + Intronic
1064600294 10:16986014-16986036 CTGTGTGTATGTGTGGGGCTGGG + Intronic
1065177868 10:23096003-23096025 GTGGGGGCATAAGTGGGGCTCGG + Intronic
1067202464 10:44185194-44185216 GTGTGTGCATGTGTGGGTGTGGG + Intergenic
1067498633 10:46781862-46781884 GTGTGTGTGTGTTTGGGGGTGGG - Intergenic
1068290452 10:54995635-54995657 GTGTGTGTGTGTTTGGGGCGTGG - Intronic
1068295279 10:55062819-55062841 GGTTGTGCATTTTTGGGGCAGGG + Intronic
1071775757 10:88786229-88786251 GTGTGTGTACATGTGGGGCCAGG - Intergenic
1072603833 10:96960207-96960229 CTGTGTGCTTACTTGGGGGTAGG - Intronic
1072623413 10:97095862-97095884 TTGTGTGCACATTAGTGGCTGGG - Intronic
1073366677 10:102948498-102948520 GTGTGTGCATGTTGAGGGGTAGG + Intronic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074525640 10:114260876-114260898 GCTTGTGCATCTTTAGGGCTGGG - Intronic
1074528910 10:114283411-114283433 GAGTGTCCCTATTTGGGGTTAGG + Intronic
1074823417 10:117198064-117198086 GGGTGAGCAAATCTGGGGCTGGG + Intronic
1075721495 10:124590210-124590232 GTGTGAGCATTATTGGGGGTGGG + Intronic
1076421167 10:130332758-130332780 GGCTGTGCATGTGTGGGGCTAGG + Intergenic
1076593282 10:131606694-131606716 GTGTGTGTTTGTTTGGGGGTTGG + Intergenic
1078968850 11:16381787-16381809 GTGTGTGTATGTTTGGGTTTTGG - Intronic
1080323702 11:31045183-31045205 GTGTGTGCATATGTGTGTGTTGG - Intronic
1081372033 11:42315999-42316021 GTATGTGCATTTTTGTGGGTAGG - Intergenic
1081743759 11:45458775-45458797 ATGTCTCCATATTTGGGTCTTGG - Intergenic
1082725729 11:56733937-56733959 GTGTGTGCATATATGTGTTTAGG - Intergenic
1082760205 11:57119995-57120017 ATGTGAGTATATTTGGAGCTAGG + Intergenic
1083067538 11:59940682-59940704 GTGTGTGCATATCTAGGAATGGG + Intergenic
1084488310 11:69463893-69463915 GTGTGTGATGATTTGGGGCGGGG - Intergenic
1084523480 11:69680903-69680925 GTGTGTGCATGTGTGTGGGTCGG - Intergenic
1085470075 11:76752283-76752305 GTGTGTGTATGTTTGGGGGTGGG + Intergenic
1086340491 11:85843562-85843584 GTGTGTGCAGGCTTGGAGCTGGG + Intergenic
1086765814 11:90693819-90693841 CTGTGTGCAGCTTTGGGACTTGG + Intergenic
1086964187 11:93010682-93010704 GGGTGTGGATATTTGGGGTCTGG - Intergenic
1087575399 11:99983780-99983802 GTGTTTGCATATATTGGCCTGGG + Intronic
1089112668 11:116069157-116069179 GTGTGTGTGTGTCTGGGGCTAGG - Intergenic
1089298696 11:117484933-117484955 GTGTGTGTGTAAGTGGGGCTGGG + Intronic
1089671731 11:120061776-120061798 GTGCTTGCCTATTTGGGGCTGGG + Intergenic
1090306501 11:125695844-125695866 GTTTATGCATTTATGGGGCTTGG - Intergenic
1090404117 11:126467023-126467045 GTGTGTGCAGATATGGGCCAGGG + Intronic
1091150843 11:133326801-133326823 GTGTGTGTACATTTGTGGGTGGG + Intronic
1091200982 11:133781198-133781220 GTAGATGCACATTTGGGGCTGGG - Intergenic
1091762646 12:3097343-3097365 GTGTGTGGCTATTTTGGGTTTGG + Intronic
1092071810 12:5637363-5637385 GTGTGTGTGTATTTGGGGTTGGG + Intronic
1092483355 12:8880431-8880453 GTGTGTGTATGTGTGGGGCGGGG + Intronic
1094454394 12:30616149-30616171 GTATGTGCATATTGGGAGGTAGG - Intergenic
1094780843 12:33790083-33790105 CTGTGTGCAGGTTTGGGACTCGG - Intergenic
1094824609 12:34260262-34260284 GAGAGTCCATATTTGGGTCTGGG + Intergenic
1095949447 12:47773799-47773821 GTGTGTGTGTGTTTGGGGATAGG - Intronic
1096037331 12:48483896-48483918 GTTTGTAGAAATTTGGGGCTGGG + Intronic
1096675549 12:53223725-53223747 GTGTCTGCACCTTTGGGCCTGGG + Intronic
1097037460 12:56133240-56133262 GTATGTGCATGGTAGGGGCTGGG - Intronic
1097341165 12:58439731-58439753 GTGTGTGAATGTTTGCGGCAAGG + Intergenic
1098890680 12:76007622-76007644 GTGTGTGCATATGTGTGTCTTGG - Intergenic
1098951963 12:76648737-76648759 GGGTGTGCATGGTTGGGGCGGGG + Intergenic
1099395675 12:82135482-82135504 GTGTCTGCAGATTTGGTCCTTGG - Intergenic
1100743662 12:97622494-97622516 GTGTGTGCATTTGTGTGTCTGGG - Intergenic
1101875654 12:108595480-108595502 GTGTGTGCATGTTTGTGTGTGGG - Intronic
1104132803 12:125910509-125910531 GTGTGAGCATATTTGTACCTGGG + Intergenic
1104839211 12:131813019-131813041 CTATGTGCATTATTGGGGCTGGG - Intergenic
1104971891 12:132534533-132534555 GTGTGGGCACATGTGGGGCAGGG - Intronic
1105404165 13:20119562-20119584 GTGTGTGTGTGTTTGGGGGTCGG - Intergenic
1106365308 13:29073535-29073557 GTGTGTGTGTGTTTGGGGGTGGG + Intronic
1107906674 13:45067595-45067617 GTGTGTGTACACTTGGGGTTAGG + Intergenic
1109535516 13:63713018-63713040 GTGTGTGTGTATTGGGGGATAGG + Intergenic
1109851664 13:68073788-68073810 TTGGGTGCATATTAGGTGCTTGG + Intergenic
1111670975 13:91329965-91329987 ATGTGTGCATATGTGTGGTTGGG + Intergenic
1111881885 13:93967409-93967431 ATGTAAGCATATTTGGTGCTGGG - Intronic
1112968677 13:105231995-105232017 GCGTGTGCATGTTTGGGGGTGGG - Intergenic
1113767650 13:112890999-112891021 GTTTGTGCAGATTTGGGGGCTGG + Intergenic
1113894244 13:113753505-113753527 GTGTGTGTATATGTGTGGGTGGG - Intergenic
1113907108 13:113824618-113824640 GTGTGTACACATTTGTGACTGGG + Intronic
1114548757 14:23521576-23521598 GTGTATGCATTTATGGGGATGGG + Exonic
1114597864 14:23929667-23929689 GTGTGTGCATTTTGTGGGCAGGG - Intergenic
1114634552 14:24179923-24179945 GTGTGTGTGTATGTGGGGCAGGG + Intronic
1114759685 14:25299460-25299482 GTGTGTGCGATTTTGGGGCAGGG - Intergenic
1115027410 14:28760786-28760808 GTGTGTGTGTATGTGGGGGTGGG - Intergenic
1115374994 14:32665099-32665121 CTGTGACCATATTTGGGGGTGGG + Intronic
1116281577 14:42914985-42915007 CTGTGTGCAGATTGGGGACTTGG - Intergenic
1116340296 14:43714208-43714230 GAGTGTGAATATTTTGGGCTGGG - Intergenic
1117221891 14:53614405-53614427 GTGTGTGTGTGTTTAGGGCTTGG - Intergenic
1117516576 14:56507810-56507832 GTGTGTGCATACCTGGGGCTGGG + Intronic
1118116530 14:62783187-62783209 ATGTGTGTATGTTTGGGGGTGGG - Intronic
1119663624 14:76468408-76468430 GTGTGTGCGTGTTTGGGGGGTGG - Intronic
1120751836 14:88204801-88204823 GGCTGTGCATGTTTGGGGCGGGG - Intronic
1121666002 14:95672889-95672911 GTGTGTGTATGTTGGGGGTTGGG + Intergenic
1123080260 14:105689570-105689592 GTGTGTGTATATATAGGGGTAGG - Intergenic
1124250718 15:28104997-28105019 GTGTGTGCATGTGTGGGGTATGG + Intergenic
1124250766 15:28105307-28105329 GTGTGTGCATGTGTGGGTGTGGG + Intergenic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124598988 15:31115883-31115905 GTGTAGGCAGATTTGGGGCCTGG + Intronic
1125249131 15:37679218-37679240 ATGTGTGCATGTGTGGGGGTGGG + Intergenic
1128458723 15:67849927-67849949 GTGTGACCATATTTGGAGATTGG + Intergenic
1129191551 15:73940770-73940792 GTGTGTACATAGTCAGGGCTGGG + Intronic
1129555569 15:76504878-76504900 CTGTGTTCACATTTGTGGCTGGG + Exonic
1129831845 15:78675826-78675848 GTGTGTGTATGGGTGGGGCTGGG + Intronic
1129882645 15:79017251-79017273 CCGTGTGCATAATTGAGGCTGGG + Intronic
1132078056 15:98839413-98839435 GTGTGAGCATATATGTGGCTGGG - Intronic
1133542794 16:6772681-6772703 GTGTGTGTATATGTGGGTGTGGG + Intronic
1133927220 16:10203000-10203022 CTGTTTGCTTCTTTGGGGCTGGG - Intergenic
1135166833 16:20146571-20146593 GTGTGTGTTTAATTGGAGCTAGG - Intergenic
1136555041 16:31002589-31002611 GTGTGTGCAGACATGAGGCTCGG - Intronic
1136702262 16:32154988-32155010 GTGTGTGCATACGTGTGACTGGG - Intergenic
1136765404 16:32772500-32772522 GTGTGTGCATACGTGTGACTGGG + Intergenic
1136802695 16:33097884-33097906 GTGTGTGCATACGTGTGACTGGG - Intergenic
1137932554 16:52602859-52602881 GTGTGTGTATATGTGGGGTGGGG - Intergenic
1138375249 16:56558857-56558879 GTGTGTGCATATATTTGGGTTGG + Intergenic
1139635365 16:68255370-68255392 GTGCCTGCTTACTTGGGGCTCGG - Exonic
1139648119 16:68346765-68346787 ATGTGTGCATTTTGGGGGATGGG + Intronic
1140487072 16:75301928-75301950 GTGAGTGGAGATGTGGGGCTGGG + Intronic
1140999878 16:80298286-80298308 GTGTTTGCTGAATTGGGGCTTGG - Intergenic
1141395356 16:83699612-83699634 GTGTGTGCATATGTGTGCCAAGG - Intronic
1141888481 16:86910132-86910154 GTGTGTGCATATTATGGGGTGGG - Intergenic
1142003798 16:87679669-87679691 GTGTGTGCACGTGTGGGTCTGGG + Intronic
1203067793 16_KI270728v1_random:1034727-1034749 GTGTGTGCATACGTGTGACTGGG + Intergenic
1143825004 17:9598404-9598426 GTGTGTGTGTACATGGGGCTGGG + Intronic
1144521995 17:15959003-15959025 GTGTGTGTATAATCGGGGGTGGG + Intronic
1144841581 17:18189849-18189871 GTGTGTACAGAATTGGGACTTGG + Intronic
1145885824 17:28381822-28381844 GTGGGTGCAGATGTGGGGTTGGG + Intronic
1146009099 17:29179998-29180020 GTGTGGGGGGATTTGGGGCTTGG - Intronic
1146051267 17:29555470-29555492 GTGTGTACATATATGGGGGTGGG + Intergenic
1146271167 17:31486974-31486996 GTGTGTGCATGTGTGGGTGTGGG + Intronic
1146404890 17:32528527-32528549 GGATGTGGATATTTGGGGGTGGG - Intronic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147608800 17:41789252-41789274 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
1148552177 17:48557063-48557085 GTGTCTGCAGATTTGGGACAGGG + Intronic
1148960966 17:51392469-51392491 GTGTGTGTATATCTGGAGCAGGG + Intergenic
1151512394 17:74569254-74569276 GTGTGTGCATGTGTGGGCGTGGG + Intergenic
1152733492 17:81985237-81985259 GTGTGTGCATATGTGTGTGTGGG - Intronic
1153629574 18:7056605-7056627 GTGTGTGGACATTTGGGGGCAGG - Intronic
1154082344 18:11270188-11270210 GTGTGTGTGTATTTTAGGCTTGG + Intergenic
1154991975 18:21606091-21606113 GTATAAGAATATTTGGGGCTGGG - Intergenic
1156207922 18:34906230-34906252 CTGTGTGCAGCTTTGGGACTTGG - Intergenic
1156630462 18:38962217-38962239 GTTTGTGCTTATATGGGGGTGGG - Intergenic
1157477766 18:48034411-48034433 GTGTGTGCATGTCTTGTGCTTGG + Intronic
1157589499 18:48827899-48827921 ATGTGTGTATGTTTGGGGCGTGG - Intronic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1158586934 18:58747301-58747323 GTGAGTGGATTTTTGGGGGTGGG + Intronic
1159183213 18:64937474-64937496 GTGTGTGCATATTTGTGTGAGGG - Intergenic
1159771701 18:72553538-72553560 ATGTGTGCATATTTTTGGTTAGG + Intronic
1159856775 18:73598340-73598362 GTGTGGCCATAAGTGGGGCTTGG + Intergenic
1159932122 18:74323863-74323885 ATGTGTGCATATTTGGGATGTGG - Intronic
1160957018 19:1698532-1698554 GTGGGAGCATATTTGGGACTGGG - Intergenic
1161802977 19:6426013-6426035 GTGTCTGGATACTTGGGCCTAGG - Intergenic
1162342990 19:10102949-10102971 GTGTGTGCGTGTCTGGGGCTGGG - Intergenic
1162777634 19:12989652-12989674 GTGTGTGCATATGAAAGGCTGGG + Intergenic
1162777640 19:12989680-12989702 GTGTGTGCATATGGAAGGCTGGG + Intergenic
1162777654 19:12989766-12989788 GTGTGTGCATATGGAAGGCTGGG + Intergenic
1166303947 19:41927489-41927511 GGGTGTGGATATCTGGGACTGGG - Intronic
1166818288 19:45560391-45560413 CTCTGTGCCTATCTGGGGCTGGG - Intronic
1167677020 19:50893596-50893618 GTGTGTGCATGTTTGGAGGGCGG + Intergenic
1167955962 19:53064035-53064057 GTGTGTGTATCTTTGGGGGTGGG - Intergenic
1168312151 19:55465680-55465702 GTGGGGGCATATTGGGAGCTGGG + Intergenic
1168507758 19:56950705-56950727 GTGTGAGCATATTTGAAGATGGG + Intergenic
925088933 2:1137415-1137437 GTGTGTGCATGTGTGGGTGTGGG - Intronic
925680189 2:6412211-6412233 GTGAGTGGTTATATGGGGCTTGG - Intergenic
925689426 2:6506000-6506022 GTGTTAGCATATTTGGTCCTTGG + Intergenic
925786916 2:7440544-7440566 GTGTGTGCATATGTTGGGGTAGG + Intergenic
925829849 2:7883279-7883301 GTGTGACCATATTTGGAGATAGG + Intergenic
926140999 2:10368355-10368377 GTGTGTGCATATGTGTGTGTAGG + Intronic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926912146 2:17861006-17861028 TTGTGTACATATGTGGGGGTGGG + Intergenic
927126126 2:20013221-20013243 GTTTGTGGATATTTGAAGCTCGG - Intergenic
927876890 2:26663020-26663042 GTGTGTGCATGCATGGGGTTGGG - Intergenic
929078772 2:38101086-38101108 GTGTGTGTGTATGTGGGGGTGGG + Intronic
929544527 2:42847117-42847139 GGGTGTGTGTATTTGGGGCCGGG + Intergenic
929858351 2:45654130-45654152 GTGTATGCAGATGAGGGGCTTGG + Intronic
929888082 2:45896073-45896095 GTGTAAGCATATCTGGGTCTTGG + Intronic
930568418 2:53052918-53052940 GGCTGTGCATGTTTGGGGCAGGG - Intergenic
931145243 2:59509419-59509441 GTCTCTGCATATGTGGGGATGGG + Intergenic
931201981 2:60106323-60106345 GTGTGTGCAAAGGTGGGGGTGGG - Intergenic
932084061 2:68742130-68742152 ATGTGTGCATATTTTGGGGGTGG - Intronic
932607139 2:73172867-73172889 CTGTGTGCATGTATGGGGCTGGG - Intergenic
934014623 2:87866701-87866723 GTGTCTGCACATGTGGGGCGAGG + Intergenic
934521035 2:95020423-95020445 GTCTCAGCATGTTTGGGGCTAGG - Intergenic
935252585 2:101277330-101277352 GTGTTTGCATAGTTGAAGCTCGG - Intronic
935284321 2:101550610-101550632 GTGGGTGCATATTAGGGGGTGGG - Intergenic
935872058 2:107461582-107461604 GTGTGTGTGTATTTGGGGCAGGG + Intergenic
937346959 2:121132067-121132089 GTGTGTGCTTATATGACGCTAGG + Intergenic
937927641 2:127179462-127179484 ATGTGGGCATCTTTGGGGCAGGG + Intergenic
939099159 2:137874636-137874658 GTGTGTGTATATTTGGTGGGCGG + Intergenic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
939903862 2:147885587-147885609 GTGAATGGATATTTGTGGCTTGG + Intronic
941278000 2:163515142-163515164 GTGTGTGTGTGTTTAGGGCTGGG - Intergenic
942561670 2:177226531-177226553 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
942708839 2:178808910-178808932 GTTTGTGCATATTTGTGTGTGGG + Intronic
942861094 2:180613122-180613144 GCGTCTGCATATTTGGGGTCTGG + Intergenic
945226623 2:207537350-207537372 GTCTTTACATATTTGGGGATGGG + Intronic
945377977 2:209101613-209101635 GTGTGTACATATGTGGGGGGTGG + Intergenic
946449459 2:219767355-219767377 GTGTGTGCATGTGTGTGGGTGGG + Intergenic
946575586 2:221071929-221071951 CTGTGTGCACCTTTGGGACTTGG - Intergenic
946592955 2:221271735-221271757 GTGTGTGCATGGCAGGGGCTGGG - Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948179770 2:235970486-235970508 GTGTGTGCACCTTAGGGGCGTGG - Intronic
1168774641 20:437591-437613 GTGGGTGCCTATTTGGGAGTAGG + Exonic
1168801081 20:643475-643497 GTGTGTGTATTTTTGGGGAAAGG + Intergenic
1171984454 20:31649931-31649953 GTGTGTGCTTGTTTTGGGCCTGG - Intergenic
1172405750 20:34687605-34687627 ATGTGTGTATATTTGGGGGATGG - Intergenic
1173412557 20:42827009-42827031 GTGTGTATATATTTAGGGTTAGG - Intronic
1174412283 20:50343851-50343873 GTGTGTGCATGTGTGTGGCTGGG + Intergenic
1175219940 20:57410939-57410961 GTCTGTGCATATGGGGGTCTGGG - Intergenic
1175219967 20:57411316-57411338 GTGTGTGCACATGTGTGTCTGGG - Intergenic
1175582672 20:60112660-60112682 GTGTGTGGTTATTTGGGGACGGG - Intergenic
1175899490 20:62354427-62354449 GTGGGTGCAGATATGAGGCTGGG - Intronic
1176151788 20:63595251-63595273 GCGGGTCCAGATTTGGGGCTGGG + Intronic
1176176883 20:63732209-63732231 GTGTGTGCATGTTTGGGTGCGGG + Intronic
1176366870 21:6038594-6038616 GTGTGTGCATGTATGGTGCGTGG + Intergenic
1177683499 21:24406665-24406687 GTGTGTGCATACTTGGGTTATGG + Intergenic
1178356978 21:31917681-31917703 GTGTGTGTATGTTTGGGAATGGG - Intronic
1179756648 21:43499950-43499972 GTGTGTGCATGTATGGTGCGTGG - Intergenic
1180016891 21:45093061-45093083 TTGTGTGAATATTTGGGGGTGGG - Intronic
1180084160 21:45500249-45500271 GAGTGTGCATATGTGGGTGTTGG + Intronic
1180084179 21:45500333-45500355 GAGTGTGCATATGTGGGTGTTGG + Intronic
1182765584 22:32755731-32755753 GTGTGTGAGAAGTTGGGGCTGGG - Intronic
1183491041 22:38115753-38115775 GGGTGTGCGTGTTGGGGGCTGGG + Intronic
1183844203 22:40527117-40527139 GTGTGTGTATCTTTGAGGCGAGG - Intronic
1184250135 22:43255419-43255441 GTGTGTGCACATGTGTGTCTCGG - Intronic
1185056737 22:48583583-48583605 GTGTGTGTATATTTGGTGTGTGG - Intronic
950657242 3:14444169-14444191 GTGTGTGAATGTCTGGGGCTTGG - Intronic
950700719 3:14743859-14743881 CTGTGTGCAGCTTAGGGGCTTGG - Intronic
951126594 3:18991961-18991983 GTGTGTACATATCTGGGGATTGG - Intergenic
951811559 3:26706235-26706257 GTGTGAGGATATTTGGAGGTGGG - Intronic
953016388 3:39080843-39080865 GTATGTGCTTATTTGGGGCAAGG + Intronic
953198596 3:40756363-40756385 ATGTGACCATATTTGGAGCTAGG + Intergenic
953412888 3:42700110-42700132 GTGTGTGTATGTCTGGGTCTAGG + Intronic
953412914 3:42700390-42700412 GTGTGTGTATGTCTGGGTCTAGG + Intronic
955928891 3:64035990-64036012 GTGTGTGGATATGTGGGTGTGGG - Intergenic
956557035 3:70535784-70535806 GTGTGTCCATGTTTTGGGCCAGG + Intergenic
956690602 3:71874796-71874818 GTGTGTGCATATGTGTGGGTAGG + Intergenic
956872523 3:73431850-73431872 GTGTGTGTGTGTTTGGGGGTGGG + Intronic
957988617 3:87602982-87603004 GGGTGTGAATATTTGGGATTAGG - Intergenic
959381808 3:105650063-105650085 GTGTGTGTGTGTTTGGGGTTGGG - Intergenic
959532259 3:107447137-107447159 GTGAGTGCATATTATGGGCCAGG - Intergenic
959661600 3:108874732-108874754 GTCTGTGCAGATTCAGGGCTTGG - Intergenic
962089536 3:132228908-132228930 GTGTGTGCATATTAGAGGCAGGG + Intronic
962480985 3:135798476-135798498 GTGTGCCCATATATGGGGGTAGG + Intergenic
963065527 3:141260799-141260821 GTGTGCACAGATTTGGGGCCTGG - Intronic
963336287 3:143977433-143977455 GTGTGTAAAAATTTGGGGGTAGG - Intronic
964769249 3:160207264-160207286 GGGAATGCATATTTGGGGCATGG + Intergenic
965809733 3:172579222-172579244 CTGTGTGCAGCTTTGGGACTTGG + Intergenic
966230430 3:177645712-177645734 GTGTGTGTGTTTGTGGGGCTTGG - Intergenic
967240775 3:187437320-187437342 GTGTATGCATATGTGTGGTTGGG - Intergenic
967848686 3:194065144-194065166 ATGTGTCCCTATTTGGGGCTTGG + Intergenic
968295109 3:197570519-197570541 CTGTGTGCATCTTAGGGACTTGG + Intronic
968522942 4:1042418-1042440 GTGTGTGCATGTGTGGGTGTAGG - Intergenic
971082088 4:23224853-23224875 GTATGTGCATATATTGGGCAGGG - Intergenic
972167223 4:36302018-36302040 GTGTGGGCATGTTGGGGGCCAGG + Intronic
972558001 4:40199779-40199801 GTGAGTGCTTATTTGGGTTTGGG + Intronic
972694183 4:41428668-41428690 GTCTGTGCATTTCTGGGGCTGGG - Intronic
972889666 4:43541145-43541167 ATGTGTGTATATATGGGTCTTGG + Intergenic
973952657 4:56032864-56032886 GTGTGTGTATACCTGGGGGTGGG + Exonic
975033534 4:69654395-69654417 GTGTGTGTGTATTTGTGACTGGG - Intergenic
975171789 4:71240444-71240466 GTGTCTCCATTTTTGAGGCTTGG + Intronic
975882895 4:78931781-78931803 GTGTGCACATATTTATGGCTGGG + Intronic
976483135 4:85568292-85568314 GTGTGTGCATGTTTGTTGCGGGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978042390 4:104084091-104084113 TTGTGTGCAGATTTGGGGGATGG + Intergenic
979100715 4:116609611-116609633 GTGTGTGTATATATGGGTGTGGG - Intergenic
979353498 4:119674313-119674335 GTGTGTGCATGTTTAGGGGTGGG + Intergenic
980417876 4:132516666-132516688 GAGAGTGCACATTTTGGGCTAGG + Intergenic
981503291 4:145475053-145475075 GTCTGTGCAAACTTTGGGCTTGG + Intergenic
982069611 4:151683652-151683674 GGGTGCGCATATTTGAGGCTTGG + Intronic
982261548 4:153498539-153498561 GTGTGTGTATTTTTGGAGGTGGG + Intronic
982546327 4:156737601-156737623 GTGTGTGTGTGTTTGGGGCATGG + Intergenic
982610993 4:157574587-157574609 GTATGTGCATGCTTGGGGCAGGG + Intergenic
983576223 4:169264391-169264413 ATGTGGCCATATTTGGGGATAGG - Intronic
983618216 4:169731361-169731383 GTGTGTGTACGTTTGGGGCTAGG - Intronic
984260168 4:177435686-177435708 GTGTGTGTGTATTTTGGGGTAGG - Intronic
984677958 4:182571517-182571539 GGGTGTGCATGTGTGGGGCAGGG - Intronic
984788989 4:183596517-183596539 GTGTGTGCTTAATATGGGCTTGG + Intergenic
985702435 5:1381769-1381791 GTGTGTGCACATGTGGGTGTGGG - Intergenic
985748443 5:1660820-1660842 GTGTGTGTACATATGAGGCTGGG + Intergenic
987004512 5:13696056-13696078 GACTGTGCAGATTTGGGCCTGGG - Intronic
988054340 5:26074056-26074078 GTGTGTGCATGTGTGGGTTTGGG + Intergenic
988500405 5:31779159-31779181 GTGTGTGCAGTGGTGGGGCTGGG - Intronic
988935767 5:36081582-36081604 GTGTGTGCATGTGTGTGGGTGGG - Intergenic
990425432 5:55683574-55683596 GTGTGTACATATATGTGTCTAGG - Intronic
990744819 5:58949266-58949288 GTGTATGCATATCAGAGGCTTGG + Intergenic
990794044 5:59519897-59519919 GTGTGTGTGTATTTGGGGGGTGG - Intronic
991488431 5:67162254-67162276 GTGTCTGCATATTTAGGGGTAGG + Intronic
995565035 5:113425570-113425592 GTGGGTGCATATTTGGAGGGAGG + Intronic
997338961 5:133127448-133127470 GGGTGTGCAAATTTGGGGCTAGG + Intergenic
998786179 5:145711519-145711541 GTGGCTGCAGATTTGTGGCTGGG - Intronic
998858078 5:146414165-146414187 GCGTGTGCATTTTTTGGGGTCGG + Intergenic
998877771 5:146618039-146618061 GTGTAGACATATTTGGGGATGGG - Intronic
999020367 5:148158881-148158903 GAATGTGCTTATTTGGGGCCAGG - Intergenic
999269436 5:150288088-150288110 GTGTGTGCATGTGTGAGGCCTGG - Intronic
999272652 5:150306126-150306148 GTGTGTGCATGTTAGTGGCTAGG + Intronic
1000108550 5:158084607-158084629 GTGTGTGTATGTTTGTGGGTGGG + Intergenic
1000764109 5:165264512-165264534 GTGTGTGCATATTTTTAACTAGG - Intergenic
1002086426 5:176778653-176778675 GTGTGTGTGTATTTGGGGAGGGG - Intergenic
1002090200 5:176800453-176800475 GTGTGTGCATTTCTGGGTGTAGG + Intergenic
1002090210 5:176800522-176800544 GTGTGTGCATGTCTGGGTGTGGG + Intergenic
1003781063 6:9427371-9427393 GTGTGTGCATGTGTGGGTGTGGG + Intergenic
1003985069 6:11427237-11427259 GTGTGTGCACATGTGGTGTTGGG - Intergenic
1004870110 6:19895864-19895886 GTGTGTGCTTTTTAGGGTCTCGG - Intergenic
1004901225 6:20196044-20196066 ATGTGTTCTTATTTGGGCCTTGG + Intronic
1005155513 6:22801694-22801716 TTGTGTGTGTATTTGGGGGTTGG - Intergenic
1005230414 6:23695132-23695154 GTGTGTGTATATGTGGTGATGGG - Intergenic
1005273074 6:24187089-24187111 GTATGAGCATGTGTGGGGCTGGG - Intronic
1006083443 6:31580663-31580685 GTGCGTGAATATTGGGGGCCCGG - Exonic
1006092561 6:31636694-31636716 GGGTGTGCATGTTGGGGGCAGGG - Intronic
1006373202 6:33657847-33657869 GTGCGTGCATGTGTGGGGCTGGG + Intronic
1006434865 6:34020845-34020867 GTGTGTGTATAACTGAGGCTGGG - Intronic
1006562630 6:34926819-34926841 TAGTGTGCAACTTTGGGGCTTGG + Intronic
1006664570 6:35683168-35683190 GTGTGTGTGTATTTGAGACTGGG + Intronic
1007733450 6:43965752-43965774 CTGTGTGTATATTGGGGGTTGGG - Intergenic
1009778525 6:68237715-68237737 TTGTGTGCATATTTGGGGTAGGG - Intergenic
1010092120 6:71995476-71995498 GTGTGTGTATGTTTGTGTCTGGG + Intronic
1010349174 6:74851273-74851295 GTGTGTGTGTGTTTGGGGCAGGG - Intergenic
1010532686 6:76988586-76988608 GTGTGTGCCTGTTAGGGTCTCGG - Intergenic
1011916382 6:92511450-92511472 GTGTGTGCAGTCTTGGGACTTGG + Intergenic
1012430899 6:99162726-99162748 CTGTATGGATATTGGGGGCTGGG - Intergenic
1012477564 6:99631306-99631328 TAATGTGCATACTTGGGGCTTGG + Intergenic
1013141199 6:107336870-107336892 GTGTGTGTGTGTTCGGGGCTGGG + Intronic
1014141793 6:117952190-117952212 GTGTGTGCATGTGTAGGGCTGGG + Intronic
1014145012 6:117987521-117987543 GTCTGTGCAGAGTTTGGGCTGGG - Intronic
1014336477 6:120142853-120142875 GTGTTTGCTTGTTTGGAGCTGGG - Intergenic
1014581116 6:123138203-123138225 CTGTGTGCAAACTTGGGACTTGG + Intergenic
1015267687 6:131305184-131305206 GTATGTGCATATTTGAGGCTGGG + Intergenic
1017077044 6:150628938-150628960 GTGTGTGCATATGTGGGATTTGG + Intronic
1018480663 6:164186262-164186284 GTGTGTGCATGTTGGGGGAGGGG + Intergenic
1020029607 7:4923743-4923765 CTGTGTGCATCGTAGGGGCTCGG - Intronic
1020863105 7:13519895-13519917 GTGTAAGCATATTTGTGGTTGGG - Intergenic
1020928857 7:14368132-14368154 GACTGTGCATATGTGGGGGTAGG - Intronic
1021118089 7:16766411-16766433 GTGTGTGCATATGTGCATCTAGG + Intronic
1021184117 7:17542921-17542943 GTGTGTGTACATTTGAGGCCTGG - Intergenic
1022074325 7:26952554-26952576 GTGTGTGCATCTATGAGGTTTGG + Intronic
1024511242 7:50206774-50206796 GTGTGTGCAAAGTGGGGGGTGGG + Intergenic
1026845081 7:73694198-73694220 GACTGTGCCTGTTTGGGGCTAGG + Intronic
1026879450 7:73899589-73899611 GGGTGTAGATATTGGGGGCTGGG + Intergenic
1029978937 7:104860145-104860167 GTGTGTGTGTATTTGGGGGGTGG - Intronic
1030284713 7:107814017-107814039 GTGTGTGCATGTTTGTGTGTCGG + Intergenic
1030951207 7:115792442-115792464 CTGTGTGAATAATTGGGGCGGGG + Intergenic
1032479417 7:132234626-132234648 GTGTATGTGTATTGGGGGCTTGG + Intronic
1032590105 7:133183940-133183962 GTGTGTATATATTTGGGGGAGGG - Intergenic
1033389534 7:140913241-140913263 GTGTGTGTGTATTGGGGGATGGG - Intronic
1033620314 7:143056689-143056711 GTGGGAGGATATTTGGGGCCAGG - Intergenic
1034293558 7:149950879-149950901 GTGTGTAGGTATTTGGAGCTAGG - Intergenic
1034316246 7:150136121-150136143 GTGGGTGCAGATTTGGGGTTTGG + Intergenic
1034790612 7:153964540-153964562 GTGGGTGCAGACTTGGGGTTTGG - Intronic
1034812508 7:154145974-154145996 GTGTGTAGGTATTTGGAGCTAGG + Intronic
1034874547 7:154713664-154713686 CTGTGTGCAGACTTGGGACTTGG - Intronic
1035175311 7:157045920-157045942 GTGTGTGCATGCGTGGGGCATGG - Intergenic
1035205120 7:157289973-157289995 GTGTGTGTGTGTTTGGGGGTGGG + Intergenic
1035235928 7:157497732-157497754 ATGTGTGTATTTTGGGGGCTGGG + Intergenic
1035794831 8:2345548-2345570 GTGTGTGTAGGTGTGGGGCTTGG + Intergenic
1036085129 8:5605439-5605461 GTGTGTGTATATCTGGTGTTTGG - Intergenic
1036212201 8:6851782-6851804 GTGTGTGCATATGTGGGCGTGGG - Intergenic
1036644384 8:10602624-10602646 GTGTGTGCGTTTTTCGGGCCGGG + Intergenic
1036650715 8:10641451-10641473 GTGTGTGCATTTGTGTGGATAGG - Intronic
1037579775 8:20237581-20237603 GTGTGTGTATACATGGGGGTAGG - Intergenic
1039132274 8:34279847-34279869 GTGTGTGCATGTTTGTGGGATGG + Intergenic
1039861860 8:41466037-41466059 ATGTGAGGATATTTGGAGCTGGG + Intergenic
1040354832 8:46607682-46607704 GTGTGTGCATGTAGGGGGGTGGG + Intergenic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1043163966 8:76880126-76880148 GTGTGGGCATATTTGGTGTCTGG - Intergenic
1044630277 8:94271883-94271905 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630284 8:94271918-94271940 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044745449 8:95366439-95366461 GTGTGATCATATTTGGAGATAGG - Intergenic
1045703660 8:104896082-104896104 CTGTGTGCATATTTCTGGCAAGG + Intronic
1045962852 8:107989062-107989084 ATCTGTTCATATCTGGGGCTCGG + Exonic
1046000819 8:108419374-108419396 GGCTATGCATATTTGGGGGTAGG + Intronic
1046803788 8:118457814-118457836 GTGTGTGCTGATTGGGAGCTGGG - Intronic
1047271310 8:123361965-123361987 GTATTAGAATATTTGGGGCTGGG + Intronic
1048257333 8:132915114-132915136 GTGTGTGCATGTTGGGAGCAGGG + Intronic
1048882471 8:138882136-138882158 GTGTGTGCAGGTTTGGAGCTCGG - Intronic
1048896889 8:139000396-139000418 ATGTGTGCACTTGTGGGGCTGGG + Intergenic
1049616191 8:143576748-143576770 GTGTGTGCCCACCTGGGGCTGGG - Exonic
1050684841 9:8156599-8156621 GTGTGTGCATGTTTGTGTGTGGG + Intergenic
1051550981 9:18329049-18329071 GTGTGAGGATATTTGGAGGTGGG + Intergenic
1052105681 9:24511592-24511614 GTGTGTGCATATCTTGGAATGGG + Intergenic
1055126112 9:72719470-72719492 GAGTGTGTATATTCGGGGCAGGG + Intronic
1056245188 9:84688028-84688050 GTGTGTGCATATCCATGGCTTGG + Intronic
1056423276 9:86451211-86451233 GTGTGGCCATCTTTGGAGCTAGG + Intergenic
1058404069 9:104651911-104651933 GTAAGTGCATGTTAGGGGCTGGG - Intergenic
1060045286 9:120335591-120335613 AGCTGTGCATATGTGGGGCTGGG + Intergenic
1061979085 9:134089694-134089716 GTGTCTGCATTTTTGGGGATGGG + Intergenic
1062161455 9:135082620-135082642 GTGTGTGCATATTTGGGGCTGGG - Intronic
1186167365 X:6840836-6840858 GGTTGTGCATATGTGGGGATAGG + Intergenic
1186213942 X:7279433-7279455 GTGTGTGTATGATGGGGGCTTGG + Intronic
1187345809 X:18462617-18462639 GGGTGTGAGTATATGGGGCTGGG + Intronic
1188433256 X:30130929-30130951 GTGTGTGCACATTTTTGGCAAGG - Intergenic
1189547566 X:42057423-42057445 GTGTCACCATATTTGGAGCTAGG - Intergenic
1190262030 X:48803243-48803265 GTGTGTGTATTTTTGTGGTTTGG - Intronic
1190334692 X:49255288-49255310 GTCTGGGCATGTTTGGAGCTGGG + Intronic
1190582779 X:51904364-51904386 GAGGGTGCATCTTTGGGGTTTGG + Intergenic
1190788222 X:53674319-53674341 ATGTGTGCATATTTGGGGAGAGG - Intronic
1190929273 X:54934407-54934429 GAGGGTGCATCATTGGGGCTTGG + Intronic
1191995285 X:67088974-67088996 GTATGTGCATCTTAGGGCCTGGG - Intergenic
1193603190 X:83534248-83534270 GTGTGTGCCTATTTGCTGCTAGG + Intergenic
1194840773 X:98738562-98738584 GTGTGTGCATATTTTGGGGAGGG - Intergenic
1195211525 X:102655307-102655329 GTGATTCCTTATTTGGGGCTAGG + Exonic
1195502795 X:105621961-105621983 GTGTGTGTATATGGGGGGATGGG + Intronic
1195917886 X:109953632-109953654 GGGTGTGCATTTGTGGGGGTTGG + Intergenic
1196036402 X:111149697-111149719 CTGTGTGCAGCTTAGGGGCTTGG - Intronic
1196329971 X:114460410-114460432 GTGAGTGCATATTTGGAACTTGG + Intergenic
1196828061 X:119756636-119756658 GTGTGTGTATGTTGGGGGCGGGG - Intergenic
1196998179 X:121407307-121407329 GTGTGTGCCTGTTAGGGTCTTGG - Intergenic
1197702297 X:129608469-129608491 GTGTGTGCATAGGTGTGGGTAGG - Intergenic
1198199336 X:134399638-134399660 GTGTGTGTATGTTAGGGGTTGGG - Intronic
1199129855 X:144171810-144171832 GTGTCTGCACATGTGGGGCGAGG - Intergenic
1199202055 X:145103233-145103255 GAAGGTGCAGATTTGGGGCTTGG + Intergenic
1199741266 X:150738764-150738786 ATGTGTCCATATTTGGAGATGGG - Intronic
1199763062 X:150920037-150920059 ATTTGTGCTTATTTGAGGCTTGG + Intergenic
1199965734 X:152819109-152819131 GTGTGTGTGTGTTTGGGGGTGGG - Intergenic
1200061904 X:153487509-153487531 GGGTGTGCATGTTGGGGGCTGGG - Intronic
1200157903 X:153987323-153987345 GTGTGTGCATTTTTGAGACAGGG + Intergenic