ID: 1062162210

View in Genome Browser
Species Human (GRCh38)
Location 9:135086957-135086979
Sequence GACCTTATGCAGCTCCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062162204_1062162210 -7 Left 1062162204 9:135086941-135086963 CCAGGCCTGAGCCCCAGACCTTA 0: 1
1: 1
2: 1
3: 36
4: 309
Right 1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG No data
1062162202_1062162210 10 Left 1062162202 9:135086924-135086946 CCTTCAGCTCCTGAGGTCCAGGC 0: 1
1: 0
2: 2
3: 56
4: 536
Right 1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG No data
1062162203_1062162210 1 Left 1062162203 9:135086933-135086955 CCTGAGGTCCAGGCCTGAGCCCC 0: 1
1: 0
2: 4
3: 65
4: 527
Right 1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG No data
1062162200_1062162210 11 Left 1062162200 9:135086923-135086945 CCCTTCAGCTCCTGAGGTCCAGG 0: 1
1: 0
2: 0
3: 37
4: 353
Right 1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG No data
1062162198_1062162210 30 Left 1062162198 9:135086904-135086926 CCAGGTTCATGGGCGTGGTCCCT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062162210 Original CRISPR GACCTTATGCAGCTCCTGCC GGG Intronic
No off target data available for this crispr