ID: 1062162502

View in Genome Browser
Species Human (GRCh38)
Location 9:135087921-135087943
Sequence CCTGAAGGCCGCCTGGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062162493_1062162502 -8 Left 1062162493 9:135087906-135087928 CCGCGGTGCCCGCCGCCTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1062162490_1062162502 0 Left 1062162490 9:135087898-135087920 CCTGCCCGCCGCGGTGCCCGCCG 0: 1
1: 0
2: 3
3: 49
4: 384
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1062162492_1062162502 -5 Left 1062162492 9:135087903-135087925 CCGCCGCGGTGCCCGCCGCCTGA 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1062162491_1062162502 -4 Left 1062162491 9:135087902-135087924 CCCGCCGCGGTGCCCGCCGCCTG 0: 1
1: 0
2: 0
3: 97
4: 4765
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1062162488_1062162502 2 Left 1062162488 9:135087896-135087918 CCCCTGCCCGCCGCGGTGCCCGC 0: 1
1: 0
2: 3
3: 28
4: 342
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1062162489_1062162502 1 Left 1062162489 9:135087897-135087919 CCCTGCCCGCCGCGGTGCCCGCC 0: 1
1: 0
2: 2
3: 38
4: 392
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1062162486_1062162502 9 Left 1062162486 9:135087889-135087911 CCAGGCGCCCCTGCCCGCCGCGG 0: 1
1: 0
2: 3
3: 90
4: 612
Right 1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062162502 Original CRISPR CCTGAAGGCCGCCTGGGCGC GGG Exonic
900781779 1:4623347-4623369 CCTGAAGGACGCATGGGCCAGGG - Intergenic
900801192 1:4738146-4738168 CTTGAAGGACGCCTGGGCTTTGG - Intronic
901494516 1:9613544-9613566 GCTGAAGGCCCCCTGGGGGAGGG + Exonic
902368125 1:15990456-15990478 CCTGGAGGCCTCCTGGGCCAGGG - Intergenic
903380926 1:22896360-22896382 CCTGAAGGCGCCCAGGGAGCTGG - Intronic
905920416 1:41715393-41715415 CCTTCAGGTCGCCTGGGCCCAGG - Intronic
906322744 1:44827108-44827130 GCTGCAGGCCTCCTGGGCCCAGG - Intronic
906556673 1:46719278-46719300 CCGGAAGCCCTCCTGGGGGCGGG - Intergenic
909532740 1:76699781-76699803 CCTGGAGGGCGCCATGGCGCTGG - Intergenic
911133923 1:94418841-94418863 CCTGAGTGCTGGCTGGGCGCCGG - Intronic
912509837 1:110181717-110181739 CCTGAAGGAGGCCAGGGAGCAGG + Intronic
915562830 1:156697408-156697430 CCTGAAAGCCTCCTAGGAGCTGG - Intergenic
917671091 1:177274270-177274292 CCTGCAGGCATCCTGGGGGCAGG + Intronic
917782372 1:178411886-178411908 TCTGAAGGCCGACTGGCCCCAGG - Intronic
920971627 1:210748180-210748202 TCTGAAGGCCACCTGGACACAGG - Intronic
921923413 1:220691923-220691945 CCTGAAGCCCCCCCGGGGGCGGG - Intronic
922751855 1:228073767-228073789 CCTGCAGCCAGCCTGGGCGGGGG - Intergenic
922753800 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG + Intronic
923315277 1:232773813-232773835 CCTGAATGCTGCCTTGGCGCCGG + Intergenic
1062857553 10:786827-786849 CCTGAGAGCCGGCTGGGGGCAGG - Intergenic
1063458518 10:6201596-6201618 CCCGGTCGCCGCCTGGGCGCGGG + Intronic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1065573905 10:27099920-27099942 CAGAAAGGCGGCCTGGGCGCTGG + Intronic
1067321359 10:45224200-45224222 CCTGAAGGGCGTCCGGGTGCAGG + Intergenic
1067741061 10:48896537-48896559 CCTGAAGGTTGCCAGGGCCCAGG + Intronic
1076156804 10:128210979-128211001 CCTGGAGGCCGCGCGGGCACCGG - Intergenic
1076685895 10:132198359-132198381 CCTGAAGGGAGCCTGGGCCTTGG - Intronic
1076691392 10:132225422-132225444 CCTGGAGGCAGCCTGGTCTCGGG - Intronic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1080779852 11:35419755-35419777 CCTGAAGCCCGCGTGGCCCCAGG + Intronic
1081604834 11:44520583-44520605 CCCGAAGGACGCCTGGGTGGAGG + Intergenic
1081710476 11:45212643-45212665 CCTGCAGGCAGCCTGGGCCTGGG - Intronic
1084690168 11:70720483-70720505 CCTCATGGCCCCCTGGGAGCTGG - Intronic
1085579402 11:77637477-77637499 CCTGGAGGCCTGCTGGGAGCGGG - Intronic
1087114642 11:94512399-94512421 TCGGAAGGCCGGCTGGGGGCGGG + Intergenic
1090388113 11:126368383-126368405 CCTGAGGGCCGACTGCGAGCAGG - Intronic
1090402280 11:126456568-126456590 CCTGAAGACCACCAGGGCGGGGG - Intronic
1091361740 11:134983481-134983503 CCTGAAGGCTGTCTGTGCCCTGG - Intergenic
1091415466 12:279212-279234 CCAGTAGGCCACCTGGGCACTGG - Intergenic
1091437565 12:484683-484705 CCTGGATGCCGCCTGGCCCCAGG + Intronic
1092246591 12:6867559-6867581 CCTGGAGGGCGCCATGGCGCTGG - Exonic
1104024072 12:125013634-125013656 CAGGAAGGCAGCCTGGGAGCAGG + Intronic
1104256700 12:127146007-127146029 CGTGAGAGGCGCCTGGGCGCAGG - Intergenic
1105458821 13:20565669-20565691 GCTGAAGGCAGTCTGGGGGCAGG + Intergenic
1107951343 13:45465012-45465034 GCTGAAGGCCGCGAGGGCGGCGG + Exonic
1111630083 13:90839329-90839351 CCTGAAGGCAGCATGAGCTCAGG - Intergenic
1113571327 13:111360253-111360275 CCTGAAGGAAGCCTGTGCTCTGG + Intergenic
1114075844 14:19160770-19160792 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1114461224 14:22887153-22887175 CCTGAAGGCGGCCGGTGAGCGGG + Exonic
1114665049 14:24372710-24372732 CCTGCAGGCAGCCTGGGGGAGGG + Intronic
1115536656 14:34379547-34379569 CCTGGAGGCCTCCTGAGCTCTGG - Intronic
1119712985 14:76836393-76836415 CCTGGAGGCAGCCTGGGTCCTGG - Intronic
1121850675 14:97218979-97219001 CCCGCAGGGCGCCTTGGCGCAGG - Intergenic
1122232611 14:100314230-100314252 CGTGAAGGCCAGCTGGGAGCCGG + Intergenic
1122569207 14:102683493-102683515 CGTGGAGGCCACCTGGGCGCAGG + Intronic
1122609532 14:102972346-102972368 TGGGAAGGCCGCCTGGGCTCAGG + Intronic
1122643698 14:103177526-103177548 CTGGAAGGCCTCCTGGGTGCAGG - Intergenic
1122655785 14:103258462-103258484 CTGGAAGGCCTCCTGGGTGCAGG + Intergenic
1123199642 14:106650419-106650441 CCTGAGAGCCCCCTGGGCTCCGG + Intergenic
1202897860 14_GL000194v1_random:20421-20443 CCTGATGCCCATCTGGGCGCTGG - Intergenic
1124610191 15:31202796-31202818 CCTGAAGGCCCACTGGGCATTGG + Intergenic
1125718925 15:41835879-41835901 CCTGAAGGCCCGCTGGGCCAGGG + Intronic
1131258585 15:90876922-90876944 TGTGAAGGCGGCCTGGGCGCAGG + Exonic
1133156722 16:3880942-3880964 CCTGCGGGGCGCCTGGGCTCCGG + Intergenic
1133171161 16:3983276-3983298 ACTGAAGACCGCCAGGGCGGCGG + Exonic
1135669416 16:24362272-24362294 CCTCAGGGCCACCTGGGCGGTGG - Exonic
1136012341 16:27371943-27371965 CTTGAAGGAGGCCTGGGCACAGG + Intergenic
1136337357 16:29618977-29618999 CCTGAGGGACACCTGGGGGCTGG - Intergenic
1137673726 16:50293557-50293579 CGGGGAGGCCGCCTGGGGGCCGG - Intronic
1137768591 16:50996657-50996679 CCTGCAGCCCACCTGGGCACTGG - Intergenic
1138534785 16:57654085-57654107 CCTGGAGGCCGGCTGTGGGCTGG - Exonic
1139972403 16:70784304-70784326 CTTGGTGGCCGCCTGAGCGCTGG - Intronic
1140223906 16:73063962-73063984 CCAGAACGTCACCTGGGCGCGGG - Intergenic
1140881258 16:79200058-79200080 CCTGAAGGCTGGCAGGGCTCAGG - Intronic
1141334051 16:83138421-83138443 CCTGAAGGACGCCTAAGAGCAGG + Intronic
1141704030 16:85654970-85654992 CCTGAAGGCCGGGTGGGGGAAGG - Exonic
1142108501 16:88318837-88318859 CATGATGGCCGTCTGGACGCTGG - Intergenic
1142285132 16:89168569-89168591 CCGGGAGGCCGCCAGGGCGCTGG - Intergenic
1142350076 16:89575765-89575787 CCTGAACGCCTGCCGGGCGCGGG - Exonic
1142411359 16:89918745-89918767 CCTGCACGCCGCCTGGTGGCAGG + Exonic
1142625909 17:1191781-1191803 CCTGACGGCAGCCTGGGCGCAGG - Intronic
1142994899 17:3754772-3754794 CCTAGAGGCCACCTGGGCGAGGG - Intronic
1142994964 17:3754939-3754961 CCTGGAGGCTACCTGGGCGAGGG - Intronic
1142995008 17:3755044-3755066 CCTGGAGGCTCCCTGGGCGAGGG - Intronic
1143220171 17:5255039-5255061 CCTGAAGGCCAGTTGGGTGCAGG - Intergenic
1143379317 17:6486142-6486164 GCTGAAGGCAGCCTGGTGGCAGG - Intronic
1144670596 17:17130594-17130616 CCTGCTGGCAGCCTGGGCCCAGG - Intronic
1144832517 17:18139663-18139685 CCTGAAGGCAGGCTGGGTGTGGG - Intronic
1144876285 17:18399116-18399138 CCTGGAGGCCTCCTGGGCTAGGG - Intergenic
1145155944 17:20545304-20545326 CCTGGAGGCCTCCTGGGCTAGGG + Intergenic
1145760930 17:27425258-27425280 CCTGGAGGCCTCCTGGGCCAGGG - Intergenic
1146160970 17:30559415-30559437 CCTGGAGGCCTCCTGGGCCAGGG - Exonic
1146322723 17:31859172-31859194 CCTTCAGGCCGCCGGGGCCCAGG - Exonic
1146843398 17:36169371-36169393 CCTGGAGGCCTCCTGGGCCAGGG + Intronic
1146855708 17:36257310-36257332 CCTGGAGGCCTCCTGGGCCAGGG + Intronic
1146864913 17:36331065-36331087 CCTGGAGGCCTCCTGGGCCAGGG - Intronic
1146871614 17:36381221-36381243 CCTGGAGGCCTCCTGGGCCAGGG + Intronic
1146878974 17:36432303-36432325 CCTGGAGGCCTCCTGGGCCAGGG + Intronic
1146882914 17:36453449-36453471 CCTGGAGGCCTCCTGGGCCAGGG + Intergenic
1147067772 17:37931659-37931681 CCTGGAGGCCTCCTGGGCCAGGG - Intronic
1147074500 17:37981845-37981867 CCTGGAGGCCTCCTGGGCCAGGG + Intronic
1147079303 17:38011214-38011236 CCTGGAGGCCTCCTGGGCCAGGG - Intronic
1147086023 17:38061384-38061406 CCTGGAGGCCTCCTGGGCCAGGG + Intronic
1147095243 17:38135156-38135178 CCTGGAGGCCTCCTGGGCCAGGG - Intergenic
1147101968 17:38185349-38185371 CCTGGAGGCCTCCTGGGCCAGGG + Intergenic
1147339105 17:39743309-39743331 CATGAGGGCTGTCTGGGCGCTGG + Intronic
1147536420 17:41325482-41325504 CCTGGAGGCCTCCTGGGCCCGGG - Intergenic
1147805047 17:43125288-43125310 GGTGAAGGCCTCCTGAGCGCAGG + Exonic
1148048505 17:44758389-44758411 CCTGAAGCCCTCCTGGAGGCCGG + Intergenic
1149846560 17:60011859-60011881 CCTGGAGGCCTCCTGGGCCAGGG + Intergenic
1150084906 17:62268434-62268456 CCTGGAGGCCTCCTGGGCCAGGG + Intergenic
1150830335 17:68512738-68512760 CCTCAAGGCCGTCTGGGCGTTGG + Intronic
1152566718 17:81103623-81103645 CTTGGAGGCCGACAGGGCGCTGG - Exonic
1154092437 18:11378269-11378291 CCAGAATGCTGCCTGAGCGCAGG + Intergenic
1155218223 18:23662261-23662283 CCTGAAGCCTCCCTGGGTGCTGG + Intronic
1157496286 18:48159854-48159876 GCTGGAGGCCCCCTGGGCTCTGG - Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1158629767 18:59101609-59101631 CCTGAAGGTCCCCTGTGCTCAGG + Intergenic
1160404764 18:78637941-78637963 CCTGCAGGAGGCCTGGGCTCCGG - Intergenic
1160540114 18:79616740-79616762 CGTGGAGGCCGCCGGGGCCCGGG + Intergenic
1160597746 18:79988749-79988771 CCACCAGGCCGCCTGGACGCTGG - Intronic
1160673265 19:376304-376326 CAAGAAGGCTGCCTGGGCTCTGG - Intergenic
1160763481 19:797280-797302 CCAGAAGGCCGCCCGGGGGCGGG - Exonic
1161253371 19:3293343-3293365 CTGGATGGCTGCCTGGGCGCTGG - Exonic
1161581208 19:5082076-5082098 GCTGACGGCCGCCTTGGGGCAGG + Intronic
1161984770 19:7647226-7647248 CCTGACAGCGGCCTGGGAGCTGG - Exonic
1162683785 19:12365389-12365411 ACTGAAGGCCGGCTGGGCCAGGG + Intronic
1163260321 19:16185725-16185747 CTCGAAGGCCGCCTGGGCCGGGG - Exonic
1163442491 19:17328863-17328885 CCTGCGGGCCGTCTGGGAGCTGG - Exonic
1165089203 19:33373857-33373879 AGTGGAGGCCGCCTGGGGGCAGG + Exonic
1166702743 19:44891533-44891555 CTGGGAGGCAGCCTGGGCGCCGG + Exonic
1168010041 19:53522606-53522628 CCTGAAGGCCAGCTGGCCGGAGG - Exonic
925155849 2:1648567-1648589 CCTGAAGGCCGCGGTGGCGAAGG + Exonic
929829286 2:45334411-45334433 TCGGGAGGCCGCCAGGGCGCGGG + Intergenic
932611420 2:73202881-73202903 CCAGAAGGCCGGGTGGACGCAGG - Exonic
934717774 2:96553300-96553322 CCTGCAGGCCGGATGGGAGCAGG + Intergenic
935145438 2:100392120-100392142 GCTGGAGGCTACCTGGGCGCTGG + Exonic
936252133 2:110875071-110875093 CCTGAAGGCAGCCTCTGAGCCGG + Intronic
937283402 2:120735741-120735763 CCCGAACGCCGCCGGGGCGGGGG - Intronic
938487334 2:131724140-131724162 CTGGGAGGCGGCCTGGGCGCCGG - Intronic
938491378 2:131762966-131762988 CCTGATGCCCACCTGGGCACGGG + Intronic
938496184 2:131799360-131799382 CCTGATGCCCACCTGGGCACGGG - Intronic
942117531 2:172742858-172742880 CCTGCATGCAGCCTGGGAGCTGG + Intronic
946250228 2:218406866-218406888 CCAAGAGGCCGCCTGGGGGCTGG - Intergenic
947669029 2:231925334-231925356 TCCGAAGGCCGGCTGGGCGGCGG + Intronic
948606262 2:239137530-239137552 CTTGAAGGCCCCCTGGACCCAGG - Intronic
948889400 2:240899643-240899665 CGTAAAGGGCGTCTGGGCGCTGG - Intergenic
949019706 2:241734415-241734437 CCTGAGGGCCTCCGGCGCGCCGG - Intergenic
949040991 2:241849967-241849989 CCTGCTGGCCGCCTGGATGCTGG + Exonic
1172127880 20:32636035-32636057 CCTGAGGGGGGCCTGGGGGCTGG - Intergenic
1172661715 20:36573389-36573411 CCTGAGGGCGGGGTGGGCGCAGG + Intergenic
1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG + Exonic
1174400643 20:50273987-50274009 CCTGCTGGCTGCCTGGGAGCCGG + Intergenic
1175562115 20:59939664-59939686 CCAGAAGGCCGCGGGCGCGCCGG - Exonic
1175900112 20:62356689-62356711 CCTGGAGCCGGCCTGGGCCCTGG - Intronic
1175997186 20:62817121-62817143 TCTGGCGGCCGCCGGGGCGCAGG + Exonic
1176016914 20:62938436-62938458 CCTGACTGCCCCCTGGGCACCGG - Intronic
1176040744 20:63064559-63064581 GCTGGAGGCCGCCCGGGCTCTGG + Intergenic
1176366790 21:6038052-6038074 TCCGAAGGCTGCCTGCGCGCTGG + Intergenic
1176555711 21:8253274-8253296 CCTGACGGCGGCGCGGGCGCAGG - Intergenic
1176617544 21:9036410-9036432 CCTGATGCCCATCTGGGCGCTGG - Intergenic
1179756728 21:43500492-43500514 TCCGAAGGCTGCCTGCGCGCTGG - Intergenic
1179982129 21:44901116-44901138 CCTCCAGGCCGGGTGGGCGCTGG - Intronic
1180100373 21:45581192-45581214 TCTGAAATCCGTCTGGGCGCAGG - Intergenic
1180291544 22:10853934-10853956 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1180494349 22:15883356-15883378 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1180876614 22:19177941-19177963 CCTGACGGCCGCCTTGGGGATGG + Exonic
1180997652 22:19973415-19973437 CCTGGAGACCGCCTGTGTGCAGG + Intronic
1181656659 22:24306471-24306493 CCTGAAGACCGCTTGAGCCCAGG - Intronic
1182280870 22:29217098-29217120 CATGGGGGCCGCCTGGGCCCAGG + Intronic
1182795032 22:32985671-32985693 CATGAAGGACGCCAGGGCTCTGG - Intronic
1185055474 22:48576489-48576511 CCTGAAGGCGCTCTGGGCACTGG + Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
952152315 3:30606696-30606718 CCTGGAGGCCGGCGAGGCGCGGG - Exonic
953061207 3:39429849-39429871 CCTGTAAGCCGCGTGGGCTCTGG + Intergenic
953770572 3:45776127-45776149 CCTGAAGGCAGACTGGGAGTTGG + Intronic
954458406 3:50612193-50612215 CCAGAAGGCAATCTGGGCGCGGG - Intronic
954709730 3:52499508-52499530 CCTGAAGGTGGCCTGGGCCAAGG - Intronic
955298708 3:57756935-57756957 CGTGGAGGCCGGCGGGGCGCGGG - Exonic
958056342 3:88417331-88417353 ACAGAAGGTCGCCTGGGAGCTGG + Intergenic
960884986 3:122384363-122384385 CCTGAAGCCTTCCTGGGCCCCGG + Intronic
965534712 3:169812476-169812498 CCGGGAGGCCGCCCGTGCGCCGG - Exonic
967890107 3:194358957-194358979 CCCGGAGGGGGCCTGGGCGCAGG + Exonic
968625998 4:1626953-1626975 CCTGGAGGCTGCCTGAGGGCAGG + Intronic
968642471 4:1721502-1721524 CTTGATGGCCGCCGGCGCGCCGG - Intronic
968649595 4:1755216-1755238 CACGAAGGCAGCCTGGGCGGGGG + Intergenic
968740832 4:2330988-2331010 CCTGCAGGCCACGTGGGCGGTGG + Intronic
969651302 4:8469784-8469806 CCTGAAGGCCGCCTGTGGGCGGG - Intronic
972971803 4:44585457-44585479 CTTGCAGGCCAGCTGGGCGCAGG + Intergenic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
977781573 4:100986762-100986784 CCTGATGGCCACTTTGGCGCTGG - Intergenic
985400444 4:189588179-189588201 CCTGGGGGCGGCCTGGGAGCGGG - Intergenic
985663474 5:1169249-1169271 CGTGAGGGACGCCTGGGCCCTGG + Intergenic
990471910 5:56123236-56123258 CCTGGAGGCAGCCTGGCAGCTGG + Intronic
990954191 5:61327819-61327841 CCTGCAGGCCTCCTAAGCGCAGG + Intergenic
991676611 5:69094469-69094491 CCCGGAGGCAGCCTGCGCGCAGG - Intronic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
992678244 5:79127198-79127220 CCTGAAGGCCTGTTGGGAGCTGG + Intronic
997771155 5:136555835-136555857 CCTTAAAGCAGCCTGGGCACTGG + Intergenic
1001959515 5:175871828-175871850 CCCCAAGGCTGCCTGGGCACCGG + Intronic
1002435475 5:179228452-179228474 CCTGAAGACCTCCGGGGCCCTGG + Intronic
1003139519 6:3458360-3458382 TCTGAAGGCTGCCGGGGGGCGGG + Intergenic
1006665276 6:35688875-35688897 CCAGCAGGCCGCCCGCGCGCCGG + Intronic
1007557785 6:42781896-42781918 CATGAAGGCCGGGCGGGCGCGGG + Intronic
1010094662 6:72027242-72027264 CCACAAGGCCTCCTGGGCTCAGG - Intronic
1011519949 6:88194394-88194416 CCTGAATGGTGCCTGGGGGCTGG + Intergenic
1013538758 6:111087574-111087596 CCTCGCGGCCGCCTGCGCGCTGG + Exonic
1013972497 6:116038748-116038770 CCTGGAGGTCGCCATGGCGCTGG - Intronic
1017653198 6:156601702-156601724 CCTGAAGGCAGGCTGGCTGCAGG + Intergenic
1019088170 6:169501273-169501295 CCTGCAGGCCGTCTGGACACTGG - Intronic
1019135295 6:169904021-169904043 CCTGGAGGCCGCCTGCCTGCAGG - Intergenic
1019300244 7:299399-299421 CCTAAAGGCCCCCTTGGCCCTGG - Intergenic
1019793758 7:3034706-3034728 GCAGAAGGCCGTCTGTGCGCCGG - Intronic
1020586765 7:10079013-10079035 CCTGAAGCCTGCCTGGGGCCAGG + Intergenic
1024109698 7:46132661-46132683 CATGAAGGCAGCATGGGCGGGGG + Intergenic
1024520973 7:50304131-50304153 CCCAAAGGCCGCCGGGGCGGCGG - Intronic
1024794813 7:53008045-53008067 CCTGTAGGTAGCCTGGGGGCTGG + Intergenic
1025936869 7:66044554-66044576 TCTGAAGTCGGCCTGGGCGAAGG - Intergenic
1028261657 7:88674047-88674069 ACTGCAGGCTGCCTGGGAGCTGG + Intergenic
1028263054 7:88687087-88687109 TGTGGAGGCAGCCTGGGCGCAGG - Intergenic
1032011934 7:128352493-128352515 CCTGGAGGCCGACTGGGCAGAGG - Exonic
1032108619 7:129056011-129056033 CCTGGAGGGCGCCATGGCGCTGG - Intergenic
1034531597 7:151699287-151699309 CCTGCAGGCAGCCTGACCGCAGG - Intronic
1036398092 8:8385904-8385926 ACGGAAGGCCGCCTGGCTGCTGG - Intronic
1036560364 8:9896594-9896616 CATGAAGGCCTCCTGGGCAAAGG - Intergenic
1036787157 8:11695654-11695676 CCTGATGGCTGCCTGGGAGAGGG - Intronic
1037473870 8:19237551-19237573 TCTGGAGACCGCCCGGGCGCTGG + Intergenic
1039453719 8:37695284-37695306 CCCAGAGGCCGCCTGGGGGCAGG - Intergenic
1039841922 8:41299958-41299980 CCTGCAGGCTGCCTGAGAGCAGG - Intronic
1039934916 8:42034006-42034028 CTTGAAGTCAGCCTGGGAGCAGG + Intronic
1043176442 8:77028154-77028176 CCTGAAGATCACCTGGCCGCTGG - Intergenic
1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG + Intergenic
1044999641 8:97868837-97868859 TCTGATGCCCGCCTGGGCTCAGG + Intronic
1048880015 8:138864274-138864296 CCTTAAAGCCCCCTGGGCCCAGG - Intronic
1049216182 8:141409427-141409449 CCTGCAGGCAGACTGGGTGCCGG - Intronic
1049426795 8:142541374-142541396 CCTGAGGGCCGCCTGGTCCCTGG - Intronic
1049553441 8:143271058-143271080 CCTGGAAGCCTCCTGGGCACTGG + Intronic
1049599273 8:143499457-143499479 ACTGAACACCGGCTGGGCGCAGG - Intronic
1057206950 9:93179155-93179177 CCTCAGGGCCACCTGGGAGCCGG + Intergenic
1057894279 9:98894665-98894687 CCTGAGGGCTGCCTGGGGGTTGG + Intergenic
1061484841 9:130914973-130914995 GCTCACGGCCGCCTGGCCGCTGG - Intronic
1061617157 9:131787787-131787809 CCTGGAGGCTGCCCGGGCGCAGG + Intergenic
1061847456 9:133395635-133395657 CCTTCAGGCTGCCTGGGCTCTGG - Exonic
1061895219 9:133643559-133643581 CGTGCTGGCCGCCTGGGCCCTGG + Exonic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062222190 9:135422685-135422707 CCTGGAGGCTGCCTGGGAGCGGG + Intergenic
1062428620 9:136517200-136517222 CCTGAGGGGTGCCTGGGCGTGGG - Intronic
1062708682 9:137960040-137960062 CCTGAGGGACGCCGGGGCGGGGG + Intronic
1190101714 X:47527166-47527188 CCTGGATGCTGCCTGGGCCCGGG - Intergenic
1192366408 X:70477452-70477474 TCTGGAGACCGCCTGGGTGCTGG - Intronic
1199511762 X:148630476-148630498 ACTGAAGGTCACCTGGGTGCAGG + Intronic
1200292649 X:154886967-154886989 CGTGAAGACCGCCAGGGCGCCGG - Exonic
1200339493 X:155382707-155382729 CGTGAAGACCGCCAGGGCGCCGG - Exonic
1200346977 X:155457986-155458008 CGTGAAGACCGCCAGGGCGCCGG + Exonic