ID: 1062162601

View in Genome Browser
Species Human (GRCh38)
Location 9:135088295-135088317
Sequence CAGGGTCGCCACCGCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062162601_1062162618 30 Left 1062162601 9:135088295-135088317 CCGGCGCAGCGGTGGCGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1062162618 9:135088348-135088370 TCTCCGCCCGCGCGCCCCTGGGG No data
1062162601_1062162616 28 Left 1062162601 9:135088295-135088317 CCGGCGCAGCGGTGGCGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1062162616 9:135088346-135088368 CATCTCCGCCCGCGCGCCCCTGG No data
1062162601_1062162605 -1 Left 1062162601 9:135088295-135088317 CCGGCGCAGCGGTGGCGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1062162605 9:135088317-135088339 GCTCCCCGCTCCCCCAGCCTGGG 0: 1
1: 2
2: 5
3: 58
4: 567
1062162601_1062162617 29 Left 1062162601 9:135088295-135088317 CCGGCGCAGCGGTGGCGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1062162617 9:135088347-135088369 ATCTCCGCCCGCGCGCCCCTGGG No data
1062162601_1062162604 -2 Left 1062162601 9:135088295-135088317 CCGGCGCAGCGGTGGCGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1062162604 9:135088316-135088338 TGCTCCCCGCTCCCCCAGCCTGG 0: 1
1: 1
2: 2
3: 55
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062162601 Original CRISPR CAGGGTCGCCACCGCTGCGC CGG (reversed) Intronic
903167293 1:21529795-21529817 CAGGGTCTCCACTGTTGCCCAGG + Intronic
904263354 1:29303859-29303881 CAGTGACCCCACCGCTGCGCTGG - Exonic
904291397 1:29488357-29488379 CAGTGACCCCACCGCTGCGCTGG + Intergenic
908360927 1:63367765-63367787 ACGGGTCGCCAGCTCTGCGCCGG - Intronic
1065915131 10:30348937-30348959 CAGGGTCGCCGCCGTTGCTGAGG - Intronic
1069722311 10:70557599-70557621 CTGGGGCCCCACCGCTGGGCTGG + Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1075845801 10:125544322-125544344 AAGGGTCCCCACCTCTGCACTGG + Intergenic
1076923060 10:133465502-133465524 CCGCGTCCCCACCGCTCCGCAGG - Intergenic
1083674520 11:64318092-64318114 CTGGGCCGCCTCCACTGCGCAGG - Exonic
1086724754 11:90167948-90167970 GAGGGTTGCCACTGCTGCTCCGG - Intronic
1090273885 11:125406189-125406211 CGGGGTTTCCACCGCTGCTCTGG + Intronic
1095098498 12:38160209-38160231 AAGGATGGCCACCCCTGCGCCGG + Intergenic
1104752812 12:131250799-131250821 CAGGGTCGGCAATGCTGCCCAGG + Intergenic
1105701275 13:22937392-22937414 CAGGGTCGCCATCACTGGGCTGG - Intergenic
1105854110 13:24360451-24360473 CAGGGTCGCCATCACTGGGCTGG - Intergenic
1105884327 13:24628997-24629019 CAGGGTCCCCACTGCTGCCATGG + Intergenic
1106396080 13:29382222-29382244 CAGGGTCTCCACCACTGCTTAGG - Intronic
1107276706 13:38687409-38687431 CAGGACCGCCACCGCCGCCCCGG + Exonic
1111396301 13:87672624-87672646 CGCGGTCGCCACCGCGGCGGCGG + Exonic
1113566945 13:111324979-111325001 CAGGGAAGCCACCGCTCCCCAGG - Intronic
1114271651 14:21103886-21103908 CTGGGTCCCCAGCCCTGCGCTGG + Intronic
1119383100 14:74240862-74240884 CAGGGTCGCGAGCGCTGCCGGGG + Intronic
1122784550 14:104157756-104157778 CACGGCCGCCACCGCTGCCTCGG - Exonic
1122917486 14:104865668-104865690 CAGGGCCGCCTCCGCGGCGGCGG - Intronic
1129386708 15:75200483-75200505 CAGGGTCGCCGGCGCGGTGCTGG + Intronic
1136382160 16:29900738-29900760 CAGGGTAGGAACCGCTGCCCAGG + Exonic
1136412788 16:30086597-30086619 CGGGGAAGCCACCGCTGCCCCGG - Exonic
1142417209 16:89949184-89949206 CGGGGACGCCGCCGCTGCTCCGG + Intronic
1143102819 17:4513682-4513704 CAGGGTCACCACGGCTCTGCTGG - Intronic
1147000631 17:37359440-37359462 CAGGGGCGCCACGACTGCCCAGG - Intronic
1148207012 17:45785214-45785236 CAGGGTCGGCCGCGCAGCGCGGG - Intronic
1149658004 17:58320344-58320366 CAGGGTGGGCACGGCTGGGCAGG - Intronic
1150488878 17:65561271-65561293 CAGCCCCGCCACCGCTCCGCAGG + Intronic
1151448468 17:74182365-74182387 CAGGGTCCCCACCCCTGGGAAGG - Intergenic
1151823163 17:76508109-76508131 CAGGGTCTCCACCGCTGACATGG + Intergenic
1155909915 18:31495561-31495583 CTGGGTAGCCACCGCTGCAGAGG + Intergenic
1157046342 18:44105480-44105502 CAGGGTCTCCACTGCTGGGTAGG - Intergenic
1157222408 18:45837510-45837532 CAGGCTCGCCAGCGCAGCGCTGG + Exonic
1158648877 18:59269342-59269364 CCGGCCCGCCACCGCTGCCCGGG + Exonic
1160455255 18:78994823-78994845 CAGGGGCGCCTCCGCTGCCCGGG - Exonic
1161234904 19:3192955-3192977 CAGGGTCCACAGGGCTGCGCAGG + Intronic
1162315596 19:9936449-9936471 CAGGGTCGCCCCGGCCGGGCGGG - Exonic
1166959128 19:46487517-46487539 CGGGGTGGGCACCGCTGCCCTGG - Intronic
1167631748 19:50629978-50630000 CTGGGCCCCCACCGCTCCGCCGG + Exonic
1167643621 19:50694835-50694857 GAGGGTCGCCACCGCGGGCCGGG + Intronic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
937983526 2:127628441-127628463 CAGTGTGGCCATCGCTGAGCTGG + Exonic
943046473 2:182867095-182867117 CAGGGTCGCAGCCGCAGCGGCGG - Exonic
949066152 2:241991466-241991488 CAGGGTCGTGCCCGCTGAGCTGG - Intergenic
1172715825 20:36962779-36962801 TAGGGTCTCCACCACTGAGCTGG + Intergenic
1172771394 20:37384475-37384497 CGGGGTCGCCCCCTCTGCGCAGG + Intronic
1181744527 22:24946594-24946616 CAGCGTGGCCACCTCTGCTCAGG + Exonic
1183581339 22:38728335-38728357 CATGGTCACCACCACTGCCCAGG - Intronic
1183818672 22:40325765-40325787 CAGGGTCGCCACTGGCTCGCAGG - Exonic
1185324309 22:50218160-50218182 CAGGGACGCAGCCGCTGCCCAGG + Intronic
964474930 3:157089618-157089640 CAGTGTAGCCACGGCTGCCCTGG + Intergenic
968128078 3:196174967-196174989 CAGGGTCGCAGCCACTGCCCTGG - Intergenic
968491519 4:892921-892943 CAGGGTCACCACCGCAGCCCAGG - Intronic
969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG + Intergenic
974189948 4:58491832-58491854 CAGGGTTGCCAGGGCTGCTCAGG - Intergenic
992250363 5:74869898-74869920 CAGGGTCTCCCCAGCTGAGCTGG + Intergenic
993944506 5:94101309-94101331 CAGGGTCTCCACAACTTCGCAGG - Intronic
996398569 5:123036315-123036337 CAGGGTCTCCCCCGGAGCGCCGG + Intronic
997471856 5:134121628-134121650 CAGGGTGGCCACGGCTTCCCAGG - Intronic
1001757463 5:174181475-174181497 CAGGGTTCCCACTACTGCGCTGG + Intronic
1003392193 6:5723956-5723978 CAGCGTGGCCACCGCTCTGCAGG - Intronic
1017676192 6:156816663-156816685 CAGGGCAGCCACAGCTGTGCTGG + Intronic
1018714059 6:166518061-166518083 TAGGGTCTCCACCACTGAGCTGG + Intronic
1019414690 7:921902-921924 CAGGGTCGGCAGCCCTGCCCTGG + Intronic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1026740669 7:72976495-72976517 CGGGGTCGCCACCGCTGCTAAGG + Intergenic
1026797973 7:73377989-73378011 CGGGGTCGCCACCGCCGCTGAGG + Intergenic
1027103063 7:75388576-75388598 CGGGGTCGCCACCGCTGCTAAGG - Intergenic
1036739494 8:11347823-11347845 CAGAGTCTCCAGCGCCGCGCAGG - Intergenic
1043458155 8:80432481-80432503 CAGGGTCACCAGGGCTGCTCAGG - Intergenic
1049694087 8:143975231-143975253 CAGCGCCACCCCCGCTGCGCCGG + Intronic
1055509779 9:76984673-76984695 CAGGGTGGCCACCCCTCCCCCGG + Intergenic
1061957502 9:133971305-133971327 CTGGGTCGCCACGGCAGCCCAGG + Intronic
1061971525 9:134047931-134047953 CAGGCTGGCCCCCGCAGCGCCGG - Intronic
1062162601 9:135088295-135088317 CAGGGTCGCCACCGCTGCGCCGG - Intronic
1062574497 9:137200062-137200084 CGGGGTCTGCACCGCGGCGCGGG - Exonic
1189335157 X:40166641-40166663 CAGGGGCCCCAACGCTGAGCAGG + Intronic
1195219969 X:102737613-102737635 CAGGGTCGCTAGGGCTGCTCAGG - Intronic
1197726086 X:129777469-129777491 CAGGGACGCAGCCGCTGCGCAGG + Intergenic
1198515857 X:137405970-137405992 CTGGGGCGCCACCGCGGCTCTGG + Intergenic