ID: 1062166660

View in Genome Browser
Species Human (GRCh38)
Location 9:135111249-135111271
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166660_1062166663 -6 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166663 9:135111266-135111288 TCCGGCAAAGAAACCCTCATGGG No data
1062166660_1062166665 -2 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166665 9:135111270-135111292 GCAAAGAAACCCTCATGGGTTGG No data
1062166660_1062166675 16 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166675 9:135111288-135111310 GTTGGGGAGGGGATTTGGGCAGG No data
1062166660_1062166677 24 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166677 9:135111296-135111318 GGGGATTTGGGCAGGAACTTGGG No data
1062166660_1062166670 5 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166670 9:135111277-135111299 AACCCTCATGGGTTGGGGAGGGG No data
1062166660_1062166667 0 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166667 9:135111272-135111294 AAAGAAACCCTCATGGGTTGGGG No data
1062166660_1062166662 -7 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166662 9:135111265-135111287 TTCCGGCAAAGAAACCCTCATGG No data
1062166660_1062166676 23 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166660_1062166669 4 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166669 9:135111276-135111298 AAACCCTCATGGGTTGGGGAGGG No data
1062166660_1062166674 12 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166674 9:135111284-135111306 ATGGGTTGGGGAGGGGATTTGGG No data
1062166660_1062166678 25 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166678 9:135111297-135111319 GGGATTTGGGCAGGAACTTGGGG No data
1062166660_1062166668 3 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166668 9:135111275-135111297 GAAACCCTCATGGGTTGGGGAGG No data
1062166660_1062166673 11 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data
1062166660_1062166666 -1 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166666 9:135111271-135111293 CAAAGAAACCCTCATGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166660 Original CRISPR GCCGGAAAAGATAAAGCAAC GGG (reversed) Intronic