ID: 1062166664

View in Genome Browser
Species Human (GRCh38)
Location 9:135111267-135111289
Sequence ACCCATGAGGGTTTCTTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166664_1062166678 7 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166678 9:135111297-135111319 GGGATTTGGGCAGGAACTTGGGG No data
1062166664_1062166675 -2 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166675 9:135111288-135111310 GTTGGGGAGGGGATTTGGGCAGG No data
1062166664_1062166677 6 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166677 9:135111296-135111318 GGGGATTTGGGCAGGAACTTGGG No data
1062166664_1062166674 -6 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166674 9:135111284-135111306 ATGGGTTGGGGAGGGGATTTGGG No data
1062166664_1062166676 5 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166664_1062166673 -7 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166664 Original CRISPR ACCCATGAGGGTTTCTTTGC CGG (reversed) Intronic