ID: 1062166670

View in Genome Browser
Species Human (GRCh38)
Location 9:135111277-135111299
Sequence AACCCTCATGGGTTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166660_1062166670 5 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166670 9:135111277-135111299 AACCCTCATGGGTTGGGGAGGGG No data
1062166657_1062166670 9 Left 1062166657 9:135111245-135111267 CCCACCCGTTGCTTTATCTTTTC No data
Right 1062166670 9:135111277-135111299 AACCCTCATGGGTTGGGGAGGGG No data
1062166661_1062166670 4 Left 1062166661 9:135111250-135111272 CCGTTGCTTTATCTTTTCCGGCA No data
Right 1062166670 9:135111277-135111299 AACCCTCATGGGTTGGGGAGGGG No data
1062166658_1062166670 8 Left 1062166658 9:135111246-135111268 CCACCCGTTGCTTTATCTTTTCC No data
Right 1062166670 9:135111277-135111299 AACCCTCATGGGTTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166670 Original CRISPR AACCCTCATGGGTTGGGGAG GGG Intronic