ID: 1062166672

View in Genome Browser
Species Human (GRCh38)
Location 9:135111280-135111302
Sequence AATCCCCTCCCCAACCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166672_1062166682 27 Left 1062166672 9:135111280-135111302 CCTCATGGGTTGGGGAGGGGATT No data
Right 1062166682 9:135111330-135111352 TGTGTCGTCGAATTAGAGTGAGG No data
1062166672_1062166678 -6 Left 1062166672 9:135111280-135111302 CCTCATGGGTTGGGGAGGGGATT No data
Right 1062166678 9:135111297-135111319 GGGATTTGGGCAGGAACTTGGGG No data
1062166672_1062166677 -7 Left 1062166672 9:135111280-135111302 CCTCATGGGTTGGGGAGGGGATT No data
Right 1062166677 9:135111296-135111318 GGGGATTTGGGCAGGAACTTGGG No data
1062166672_1062166676 -8 Left 1062166672 9:135111280-135111302 CCTCATGGGTTGGGGAGGGGATT No data
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166672 Original CRISPR AATCCCCTCCCCAACCCATG AGG (reversed) Intronic