ID: 1062166673

View in Genome Browser
Species Human (GRCh38)
Location 9:135111283-135111305
Sequence CATGGGTTGGGGAGGGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166664_1062166673 -7 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data
1062166661_1062166673 10 Left 1062166661 9:135111250-135111272 CCGTTGCTTTATCTTTTCCGGCA No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data
1062166658_1062166673 14 Left 1062166658 9:135111246-135111268 CCACCCGTTGCTTTATCTTTTCC No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data
1062166657_1062166673 15 Left 1062166657 9:135111245-135111267 CCCACCCGTTGCTTTATCTTTTC No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data
1062166660_1062166673 11 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC No data
Right 1062166673 9:135111283-135111305 CATGGGTTGGGGAGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166673 Original CRISPR CATGGGTTGGGGAGGGGATT TGG Intronic