ID: 1062166676

View in Genome Browser
Species Human (GRCh38)
Location 9:135111295-135111317
Sequence AGGGGATTTGGGCAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166671_1062166676 -7 Left 1062166671 9:135111279-135111301 CCCTCATGGGTTGGGGAGGGGAT 0: 1
1: 0
2: 2
3: 32
4: 239
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166658_1062166676 26 Left 1062166658 9:135111246-135111268 CCACCCGTTGCTTTATCTTTTCC 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166657_1062166676 27 Left 1062166657 9:135111245-135111267 CCCACCCGTTGCTTTATCTTTTC 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166660_1062166676 23 Left 1062166660 9:135111249-135111271 CCCGTTGCTTTATCTTTTCCGGC 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166661_1062166676 22 Left 1062166661 9:135111250-135111272 CCGTTGCTTTATCTTTTCCGGCA 0: 1
1: 0
2: 0
3: 17
4: 247
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166672_1062166676 -8 Left 1062166672 9:135111280-135111302 CCTCATGGGTTGGGGAGGGGATT 0: 1
1: 0
2: 6
3: 25
4: 261
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data
1062166664_1062166676 5 Left 1062166664 9:135111267-135111289 CCGGCAAAGAAACCCTCATGGGT 0: 1
1: 0
2: 2
3: 6
4: 127
Right 1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166676 Original CRISPR AGGGGATTTGGGCAGGAACT TGG Intronic
No off target data available for this crispr