ID: 1062166682

View in Genome Browser
Species Human (GRCh38)
Location 9:135111330-135111352
Sequence TGTGTCGTCGAATTAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166671_1062166682 28 Left 1062166671 9:135111279-135111301 CCCTCATGGGTTGGGGAGGGGAT No data
Right 1062166682 9:135111330-135111352 TGTGTCGTCGAATTAGAGTGAGG No data
1062166672_1062166682 27 Left 1062166672 9:135111280-135111302 CCTCATGGGTTGGGGAGGGGATT No data
Right 1062166682 9:135111330-135111352 TGTGTCGTCGAATTAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166682 Original CRISPR TGTGTCGTCGAATTAGAGTG AGG Intronic