ID: 1062166923

View in Genome Browser
Species Human (GRCh38)
Location 9:135112582-135112604
Sequence TGAAAGCAGGTGTGCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166923_1062166934 27 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166923_1062166928 0 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA No data
Right 1062166928 9:135112605-135112627 GGCACCATTCTCCCAGTCGGTGG No data
1062166923_1062166936 28 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA No data
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166923_1062166929 1 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA No data
Right 1062166929 9:135112606-135112628 GCACCATTCTCCCAGTCGGTGGG No data
1062166923_1062166927 -3 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA No data
Right 1062166927 9:135112602-135112624 TCAGGCACCATTCTCCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166923 Original CRISPR TGAAAGCAGGTGTGCATGGC TGG (reversed) Intronic