ID: 1062166926

View in Genome Browser
Species Human (GRCh38)
Location 9:135112595-135112617
Sequence GGAGAATGGTGCCTGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166926_1062166936 15 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166926_1062166934 14 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166926_1062166943 29 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166926_1062166940 25 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166940 9:135112643-135112665 AGTCCGCACAGGGCCACTCTTGG No data
1062166926_1062166941 26 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166941 9:135112644-135112666 GTCCGCACAGGGCCACTCTTGGG No data
1062166926_1062166944 30 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166926 Original CRISPR GGAGAATGGTGCCTGAAAGC AGG (reversed) Intronic