ID: 1062166932

View in Genome Browser
Species Human (GRCh38)
Location 9:135112617-135112639
Sequence TGGACGGGTCACCCACCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166932_1062166943 7 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166932_1062166946 18 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166946 9:135112658-135112680 ACTCTTGGGCGGGCGTCTCCTGG No data
1062166932_1062166944 8 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data
1062166932_1062166940 3 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166940 9:135112643-135112665 AGTCCGCACAGGGCCACTCTTGG No data
1062166932_1062166941 4 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166941 9:135112644-135112666 GTCCGCACAGGGCCACTCTTGGG No data
1062166932_1062166947 19 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166947 9:135112659-135112681 CTCTTGGGCGGGCGTCTCCTGGG No data
1062166932_1062166936 -7 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166932_1062166948 28 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166948 9:135112668-135112690 GGGCGTCTCCTGGGCCGCTGTGG No data
1062166932_1062166934 -8 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166932 Original CRISPR TGGACGGGTCACCCACCGAC TGG (reversed) Intronic