ID: 1062166934

View in Genome Browser
Species Human (GRCh38)
Location 9:135112632-135112654
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166925_1062166934 23 Left 1062166925 9:135112586-135112608 CCATGCACACCTGCTTTCAGGCA No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166931_1062166934 -7 Left 1062166931 9:135112616-135112638 CCCAGTCGGTGGGTGACCCGTCC No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166926_1062166934 14 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166930_1062166934 0 Left 1062166930 9:135112609-135112631 CCATTCTCCCAGTCGGTGGGTGA No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166923_1062166934 27 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
1062166932_1062166934 -8 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166934 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type