ID: 1062166936

View in Genome Browser
Species Human (GRCh38)
Location 9:135112633-135112655
Sequence CCGTCCACCCAGTCCGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166932_1062166936 -7 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166923_1062166936 28 Left 1062166923 9:135112582-135112604 CCAGCCATGCACACCTGCTTTCA 0: 1
1: 0
2: 1
3: 22
4: 259
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166926_1062166936 15 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166931_1062166936 -6 Left 1062166931 9:135112616-135112638 CCCAGTCGGTGGGTGACCCGTCC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166925_1062166936 24 Left 1062166925 9:135112586-135112608 CCATGCACACCTGCTTTCAGGCA 0: 1
1: 0
2: 2
3: 36
4: 271
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
1062166930_1062166936 1 Left 1062166930 9:135112609-135112631 CCATTCTCCCAGTCGGTGGGTGA 0: 1
1: 1
2: 1
3: 9
4: 101
Right 1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166936 Original CRISPR CCGTCCACCCAGTCCGCACA GGG Intronic
No off target data available for this crispr