ID: 1062166941

View in Genome Browser
Species Human (GRCh38)
Location 9:135112644-135112666
Sequence GTCCGCACAGGGCCACTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166926_1062166941 26 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166941 9:135112644-135112666 GTCCGCACAGGGCCACTCTTGGG No data
1062166931_1062166941 5 Left 1062166931 9:135112616-135112638 CCCAGTCGGTGGGTGACCCGTCC No data
Right 1062166941 9:135112644-135112666 GTCCGCACAGGGCCACTCTTGGG No data
1062166930_1062166941 12 Left 1062166930 9:135112609-135112631 CCATTCTCCCAGTCGGTGGGTGA No data
Right 1062166941 9:135112644-135112666 GTCCGCACAGGGCCACTCTTGGG No data
1062166932_1062166941 4 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166941 9:135112644-135112666 GTCCGCACAGGGCCACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166941 Original CRISPR GTCCGCACAGGGCCACTCTT GGG Intronic