ID: 1062166943

View in Genome Browser
Species Human (GRCh38)
Location 9:135112647-135112669
Sequence CGCACAGGGCCACTCTTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166935_1062166943 -9 Left 1062166935 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166933_1062166943 -8 Left 1062166933 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166932_1062166943 7 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166931_1062166943 8 Left 1062166931 9:135112616-135112638 CCCAGTCGGTGGGTGACCCGTCC No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166926_1062166943 29 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data
1062166930_1062166943 15 Left 1062166930 9:135112609-135112631 CCATTCTCCCAGTCGGTGGGTGA No data
Right 1062166943 9:135112647-135112669 CGCACAGGGCCACTCTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166943 Original CRISPR CGCACAGGGCCACTCTTGGG CGG Intronic