ID: 1062166944

View in Genome Browser
Species Human (GRCh38)
Location 9:135112648-135112670
Sequence GCACAGGGCCACTCTTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062166926_1062166944 30 Left 1062166926 9:135112595-135112617 CCTGCTTTCAGGCACCATTCTCC No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data
1062166932_1062166944 8 Left 1062166932 9:135112617-135112639 CCAGTCGGTGGGTGACCCGTCCA No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data
1062166930_1062166944 16 Left 1062166930 9:135112609-135112631 CCATTCTCCCAGTCGGTGGGTGA No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data
1062166935_1062166944 -8 Left 1062166935 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data
1062166933_1062166944 -7 Left 1062166933 9:135112632-135112654 CCCGTCCACCCAGTCCGCACAGG No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data
1062166931_1062166944 9 Left 1062166931 9:135112616-135112638 CCCAGTCGGTGGGTGACCCGTCC No data
Right 1062166944 9:135112648-135112670 GCACAGGGCCACTCTTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062166944 Original CRISPR GCACAGGGCCACTCTTGGGC GGG Intronic