ID: 1062167667

View in Genome Browser
Species Human (GRCh38)
Location 9:135116051-135116073
Sequence TAGCTTCCTCTCTGGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 324}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062167667_1062167677 24 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167677 9:135116098-135116120 GAGCCTTGGGACTTGGAGAAAGG No data
1062167667_1062167675 11 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167675 9:135116085-135116107 TGGAATTTGATCTGAGCCTTGGG No data
1062167667_1062167676 17 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167676 9:135116091-135116113 TTGATCTGAGCCTTGGGACTTGG No data
1062167667_1062167679 26 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167679 9:135116100-135116122 GCCTTGGGACTTGGAGAAAGGGG No data
1062167667_1062167674 10 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167674 9:135116084-135116106 ATGGAATTTGATCTGAGCCTTGG No data
1062167667_1062167678 25 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167678 9:135116099-135116121 AGCCTTGGGACTTGGAGAAAGGG No data
1062167667_1062167673 -9 Left 1062167667 9:135116051-135116073 CCGCCTCCCCAGAGAGGAAGCTA 0: 1
1: 0
2: 4
3: 34
4: 324
Right 1062167673 9:135116065-135116087 AGGAAGCTAGCAGGCATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062167667 Original CRISPR TAGCTTCCTCTCTGGGGAGG CGG (reversed) Intronic
900317836 1:2068288-2068310 CAGCTTCCCCTCTGGGGTGGGGG - Intronic
900479485 1:2891212-2891234 CGGCTTCCTCTTTGTGGAGGGGG - Intergenic
901124045 1:6916891-6916913 GAGCTTCCACTGTAGGGAGGCGG + Intronic
901199398 1:7458052-7458074 CAGCTTCCTGTCTGGGGGTGGGG + Intronic
901630756 1:10647079-10647101 GAGCTGCTACTCTGGGGAGGAGG + Intronic
902039859 1:13484662-13484684 TGCTTTCCTCTCTTGGGAGGTGG + Intronic
902254330 1:15177823-15177845 TCGCTTCCTCTTTAGGGATGGGG - Intronic
902275081 1:15333776-15333798 TACCTGCCTCACTGGGTAGGTGG - Intronic
902340153 1:15777934-15777956 TGGCCTTCTCTGTGGGGAGGTGG + Intronic
902917710 1:19648586-19648608 TAGCTCCCACTCCGGGGAAGAGG - Intronic
903025357 1:20426317-20426339 TGGTTTCCTCTCTGGGGTGGGGG + Intergenic
903807803 1:26017798-26017820 TACCTTCATCCCTGTGGAGGAGG - Intergenic
903833398 1:26188288-26188310 TACCTTCCTCTCGGGGTGGGGGG - Exonic
904259573 1:29280570-29280592 CAGCTTCCTCTGGGGAGAGGAGG - Intronic
904445690 1:30571541-30571563 TGGCTCCCTCTCTGGGGAAACGG + Intergenic
905519285 1:38585766-38585788 CAGCTTGCGCTCTGGTGAGGAGG - Intergenic
905685250 1:39902687-39902709 TAGCCCCCGCTTTGGGGAGGCGG + Intergenic
906573042 1:46861483-46861505 TTGCTTCCTGTCTGTGGAAGAGG - Intergenic
907488631 1:54794596-54794618 TAATTTTCTTTCTGGGGAGGAGG + Intronic
911047191 1:93638276-93638298 CAGCTCCCTCCCTGGGGTGGGGG + Intronic
912413176 1:109491543-109491565 CAACTGCCTCTCTGAGGAGGAGG + Exonic
912856165 1:113170502-113170524 TAGGTTCTTCTTTGTGGAGGAGG - Intergenic
915288681 1:154868754-154868776 TAGCTTCCTCTGGGGGGTAGGGG - Intronic
917130671 1:171739204-171739226 TAGCTTCCTGGAAGGGGAGGAGG + Intronic
917630809 1:176889634-176889656 AGGCTTCCGATCTGGGGAGGGGG - Intronic
917825151 1:178812168-178812190 TATCTTCTTCACTGGGGAGAGGG + Intronic
917960122 1:180135795-180135817 CAACTTGCTCTCTGGGGATGGGG - Intergenic
918162224 1:181911870-181911892 TAGATTCTTCTCTGCTGAGGAGG + Intergenic
920374067 1:205497577-205497599 TTGCTTTCTCTCCAGGGAGGGGG + Intergenic
922738945 1:228005116-228005138 GAGCCTCATTTCTGGGGAGGTGG + Intergenic
923354478 1:233140658-233140680 TGCTTTTCTCTCTGGGGAGGAGG + Intronic
1063943202 10:11151905-11151927 TAGCCCCCTCTCTGAGTAGGAGG + Intronic
1065229392 10:23581795-23581817 TAGATTCCTTTTTGTGGAGGGGG - Intergenic
1065596661 10:27319848-27319870 CAGCGGCCGCTCTGGGGAGGCGG + Intergenic
1066294264 10:34040611-34040633 TTGCTTCCTCTCTTTGGTGGGGG - Intergenic
1069586427 10:69606992-69607014 CTGGTTCCTCTCTGTGGAGGAGG - Intergenic
1070133033 10:73668040-73668062 TTCCTTCCTCTCTTGGGAAGGGG - Intergenic
1071061800 10:81578796-81578818 AAGCTTCCACACTGTGGAGGGGG - Intergenic
1071570266 10:86692814-86692836 CAGCTTCATCCCTGGGCAGGGGG + Intronic
1071669855 10:87598228-87598250 TAGCTGGCACTTTGGGGAGGTGG + Intergenic
1071923176 10:90374556-90374578 TTGGTTCCTCTCTGTGGAAGAGG + Intergenic
1074582833 10:114736812-114736834 TAGATTCATCTGTGGGGCGGTGG + Intergenic
1074764076 10:116687592-116687614 TGTCTTTCTCTCTGGGCAGGAGG + Intronic
1075121756 10:119669675-119669697 TAGCAACCTCTATGGGGTGGGGG + Intronic
1076618178 10:131770719-131770741 TGGCTTCCCCTCCGGGGAGGTGG - Intergenic
1077118767 11:897288-897310 TAGCCTCTTGTCTGGGGTGGAGG - Intronic
1077298919 11:1838364-1838386 TATCTTCCTGCCTGGGGAGCAGG - Intergenic
1077541055 11:3146695-3146717 CAGGCTTCTCTCTGGGGAGGGGG + Intronic
1078141447 11:8696145-8696167 TATCTTTCTCTTTGAGGAGGGGG + Intronic
1078194078 11:9120420-9120442 TGGCATCATTTCTGGGGAGGTGG - Intronic
1079182165 11:18203662-18203684 TTGATTCTTCTCTGTGGAGGAGG - Intronic
1082248952 11:49959425-49959447 TTGGTTCCTCTCTGTGGAAGAGG - Intergenic
1082879356 11:58023077-58023099 TATCACCCTCCCTGGGGAGGTGG + Intergenic
1083144781 11:60750117-60750139 TAGCTGGCTGGCTGGGGAGGAGG - Intergenic
1084813621 11:71631731-71631753 TAGCTGCCTCTCTGTGGGGCAGG - Intergenic
1085507648 11:77069347-77069369 TAGTTCCCTCCCTGGGGATGAGG + Intronic
1086978351 11:93163704-93163726 CAGCTCCTTCTCTGGGGAGTAGG + Intronic
1088622427 11:111699463-111699485 CAGCATCCTATCTGGGTAGGTGG + Intronic
1089082261 11:115786632-115786654 TAGCTTCATCTCTGAGCAAGAGG + Intergenic
1089732977 11:120530993-120531015 TAGTTTCCTCTCTGCAGAGTGGG + Intronic
1089990052 11:122850581-122850603 TGGCTTCTTATCTGGGGTGGTGG - Intronic
1090113603 11:123942665-123942687 CAGCCTTCTCTGTGGGGAGGAGG + Intergenic
1090522606 11:127495363-127495385 TTGCTGGCTCTCTGGGAAGGTGG + Intergenic
1090795162 11:130129116-130129138 TAGCTTCCACTCGGGCCAGGTGG - Exonic
1091385800 12:93793-93815 TAACACCCTCTCTGGGGAGTTGG + Intronic
1092223462 12:6731048-6731070 TCGTTTCCTCCCTGGGGATGTGG + Exonic
1093269447 12:17041332-17041354 TATATTACTCTCTGTGGAGGTGG + Intergenic
1094654106 12:32404342-32404364 TAATTTCATCTCTGGGGAAGAGG + Intronic
1094809516 12:34123991-34124013 CAATTGCCTCTCTGGGGAGGGGG + Intergenic
1095348952 12:41187669-41187691 CAGCTTCCTCACTCGGGAGGAGG + Intergenic
1095372039 12:41479631-41479653 GAGCTTCCTCTCTGGAAAGATGG + Intronic
1095405608 12:41863815-41863837 TAGATTCTCCTTTGGGGAGGAGG - Intergenic
1095565872 12:43622295-43622317 TTGGTTCCTCTCTGTGGAGGAGG + Intergenic
1095587434 12:43864116-43864138 TAGCTGCCTCCCTGGGGGGCAGG + Intronic
1096912300 12:54996603-54996625 TATCTTCCTCCTTTGGGAGGAGG + Intergenic
1097077404 12:56405650-56405672 AAGCATCCTCTTTGGAGAGGTGG + Intergenic
1097946315 12:65372627-65372649 TAACTTCCCTTCTTGGGAGGTGG - Intronic
1098825721 12:75294952-75294974 TAACCTCCTCACTGGGGAGAGGG + Intronic
1101987329 12:109457797-109457819 TAGCTTGCTGGCTGGAGAGGGGG + Intronic
1103850367 12:123928983-123929005 TCTCTCTCTCTCTGGGGAGGTGG + Exonic
1105332581 13:19431944-19431966 CAGCTTACACTCAGGGGAGGCGG - Intronic
1105879105 13:24587833-24587855 CAGCTTACACTCAGGGGAGGCGG + Intergenic
1105920733 13:24961219-24961241 CAGCTTACACTCAGGGGAGGCGG - Intergenic
1106023015 13:25932403-25932425 TATTTTCCTTTGTGGGGAGGGGG - Intronic
1106308481 13:28533242-28533264 CAGCTGCCTCTCTGGGTAAGAGG + Intergenic
1106574540 13:30962415-30962437 TTGCTTCCTCCCTGTGGAGCAGG + Intronic
1109071830 13:57779228-57779250 TTGGTTCCTCTCTGTGGAGGAGG + Intergenic
1112370473 13:98788774-98788796 TTCCTGCCTCACTGGGGAGGGGG - Intergenic
1113447706 13:110382396-110382418 TATATTTCTCTCTGGGGAAGTGG - Intronic
1114216150 14:20659192-20659214 AAGCTTCAACTCTGGGGAGTTGG - Intergenic
1114465633 14:22920305-22920327 TAGGCTTTTCTCTGGGGAGGAGG - Intergenic
1115301842 14:31893660-31893682 TAGTTTCCTCAGTGAGGAGGAGG + Intergenic
1115565088 14:34618347-34618369 TGGCCTCCTTTTTGGGGAGGGGG + Intronic
1116943781 14:50816689-50816711 TAGCTTCCTGTCTGGACAGAGGG - Intronic
1118321766 14:64757631-64757653 TCCCTTCCTCTCTGGGAGGGGGG + Intronic
1118384928 14:65248178-65248200 TAGCTCCTCTTCTGGGGAGGGGG - Intergenic
1119726419 14:76924397-76924419 TGGCTTCTTCTCTGGGGTGGGGG + Intergenic
1120980107 14:90281627-90281649 TTGCTTCCCCCATGGGGAGGTGG - Intronic
1120981441 14:90292666-90292688 CAGCTTCCTGCCTGGGGCGGAGG + Intronic
1122782869 14:104150963-104150985 TGTCCTGCTCTCTGGGGAGGGGG - Intronic
1124627119 15:31314513-31314535 CAGCTTCCTCTGAAGGGAGGAGG - Intergenic
1125479517 15:40070444-40070466 CAGCTTCCTCCCCGGGGAAGTGG - Intergenic
1126999294 15:54482671-54482693 TAGGTCCCTCTGTGTGGAGGAGG + Intronic
1127331043 15:57940348-57940370 TAGCTTCATCTCTGGCAAAGTGG - Intergenic
1128083930 15:64873200-64873222 CAGCCTCCTAGCTGGGGAGGCGG + Intronic
1129696330 15:77742448-77742470 TAGTTTCCCCTCTGGAAAGGGGG - Intronic
1131581221 15:93645749-93645771 GAGCTTCCCCTCTGGGGAGATGG - Intergenic
1132544245 16:526032-526054 CAGCTGCCTCTCTGGTGGGGAGG + Intergenic
1133121629 16:3611993-3612015 AAGCTTCCTCTCAGGTGGGGTGG + Intronic
1133407093 16:5533402-5533424 TAGTTTCATCACTGGGGAAGGGG + Intergenic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1134378069 16:13697652-13697674 AAGATTCCTCTTTGGGTAGGTGG - Intergenic
1134763961 16:16739522-16739544 CAGCTCCCTTTCTGTGGAGGAGG + Intergenic
1134982093 16:18619641-18619663 CAGCTCCCTTTCTGCGGAGGAGG - Intergenic
1135028760 16:19019684-19019706 TAGCTTCCTCTCTTGTGAAGTGG + Intronic
1136413580 16:30090948-30090970 TTGCTTCCTCTCCGGGATGGAGG - Exonic
1139356415 16:66369427-66369449 TAGCTGCCTCCCTGGGCAGGAGG - Intronic
1140034077 16:71359552-71359574 TGACTTCATCTCTGGGTAGGGGG + Intronic
1140125061 16:72111861-72111883 CAGCCTCACCTCTGGGGAGGAGG - Intronic
1140240582 16:73196273-73196295 GAGCTTCCTCCTTGGGGTGGTGG + Intergenic
1140479956 16:75257082-75257104 GAGCTTCCTCTCTGAGGACGAGG - Intronic
1140860535 16:79013931-79013953 TCTCTTCCTCTCTGGGGAGGAGG - Intronic
1141212936 16:81997758-81997780 TAGCTTCCTCACTTGGGAGCTGG - Exonic
1141299656 16:82802164-82802186 TGGCCTCCTCTCTTGGCAGGTGG - Intronic
1141869448 16:86774643-86774665 TAATCTCCTCTCTGGGGAAGAGG - Intergenic
1141893957 16:86946758-86946780 CAGCAGCCTGTCTGGGGAGGTGG - Intergenic
1142051210 16:87959534-87959556 TAGCAGGCTCTCCGGGGAGGAGG + Intronic
1142254064 16:89005649-89005671 CAGAGTCCTCTCTGGGGAGGTGG - Intergenic
1142424082 16:89991596-89991618 CACCTGCTTCTCTGGGGAGGGGG + Intergenic
1144455988 17:15418641-15418663 TAGCTGCTTCTCTGAGGAGCTGG + Intergenic
1144495292 17:15741785-15741807 TAGCCTCAGCCCTGGGGAGGAGG - Intronic
1145990639 17:29077469-29077491 TAGCTTCCCATCTGGTGATGAGG - Exonic
1146884366 17:36461351-36461373 TCTCTTCCTGTCTGGGGATGAGG + Intergenic
1146976441 17:37116954-37116976 TAGGTTCCTCACTGGAGAGGCGG + Intronic
1148808780 17:50277757-50277779 TAACTTCCAATCTGGGGAGCGGG + Intronic
1149932623 17:60770762-60770784 TTGGTTCCTCTCTGTGGAGGAGG + Intronic
1150134904 17:62690161-62690183 TAGCTTATTCTTCGGGGAGGAGG - Exonic
1150303711 17:64066732-64066754 GACCTTCATGTCTGGGGAGGTGG - Exonic
1151443889 17:74150821-74150843 CAGCTTCCTCCCTGGGCAGGTGG - Intergenic
1151509942 17:74552132-74552154 TAGCTCCCTCCCTGCAGAGGTGG + Intergenic
1151787605 17:76282833-76282855 TGGGCTCCTCTCTGGGGAGTGGG + Intronic
1153056495 18:950722-950744 TTGGTTCCTCTTTGTGGAGGAGG + Intergenic
1153367980 18:4280715-4280737 TTGGTTCCTTTCTAGGGAGGAGG + Intronic
1156384180 18:36591288-36591310 CAGCTCCCTGTGTGGGGAGGAGG + Intronic
1157237883 18:45981211-45981233 CATCTTCCTCCCTGGGGTGGTGG - Intergenic
1157362711 18:47034160-47034182 GAGCTCCCTCTCTGAGGTGGAGG - Exonic
1157805512 18:50654949-50654971 GAGTTTGCTCTTTGGGGAGGAGG + Intronic
1157919020 18:51697053-51697075 TGGCCTGCTCTCTGGGGTGGAGG - Intergenic
1158748347 18:60227557-60227579 TTGCTTCTTCTTTGTGGAGGGGG + Intergenic
1159670027 18:71211927-71211949 AAGCTTCCCCTCTGTGGAAGGGG + Intergenic
1159824437 18:73189155-73189177 TTGCTACCTCTTTGGGGATGTGG - Intronic
1160119880 18:76120813-76120835 TAGCTTCTTCACTGGGCAGCAGG - Intergenic
1160354581 18:78216147-78216169 AAGCTTCTTCTCTGGGAATGAGG + Intergenic
1161632685 19:5366682-5366704 CAGCTTCCTCCCTTGAGAGGAGG - Intergenic
1161877936 19:6926314-6926336 TCGATTTCTCTCTGGGGTGGAGG + Intronic
1162361969 19:10226048-10226070 GGGCTTGCTCTCTGGGTAGGTGG - Intronic
1162822520 19:13231643-13231665 TGGCTTCCTTTCAGGGGAGTGGG - Intronic
1162839040 19:13342041-13342063 CACCATCCTCTCTGGGGAGTGGG + Intronic
1164400242 19:27897179-27897201 TGGCTTTGTCTCTGGTGAGGTGG + Intergenic
1164908251 19:31985161-31985183 TACCTTCCCCTCTGAGGATGGGG + Intergenic
1165110117 19:33497481-33497503 CAGGATCCTCTGTGGGGAGGAGG + Intronic
1165772571 19:38387733-38387755 TGGGTTCCTCTGGGGGGAGGCGG - Intronic
1167259771 19:48451818-48451840 TAGCGTCAGCCCTGGGGAGGAGG + Intronic
1167276993 19:48544950-48544972 TAGGCTCCTCTCTTGGGAGGGGG - Intergenic
1167909761 19:52691935-52691957 TAGCTTCATCCCGAGGGAGGGGG + Intergenic
925212499 2:2061923-2061945 AAGCTTTCCCTCTGGGGAGCTGG - Intronic
925296703 2:2781820-2781842 GAGTTTCTACTCTGGGGAGGCGG - Intergenic
925533561 2:4891634-4891656 TAGCTTCCCTTCTAGGTAGGTGG + Intergenic
925966951 2:9075205-9075227 TAGCTTTCACTCTTGGGAGAAGG - Intergenic
926108674 2:10168387-10168409 TAAATTCCTTTCTGGGGTGGAGG - Intronic
926904664 2:17794552-17794574 GAGCTTCCTCTCTGAGGTTGGGG - Intronic
927153308 2:20207982-20208004 GAGCTTTCTCTTGGGGGAGGCGG - Intronic
927427404 2:22996246-22996268 TCACTTCCCCTCTGGGCAGGGGG + Intergenic
928066880 2:28174407-28174429 TTGGTTCCTCTTTGTGGAGGAGG - Intronic
928405105 2:31008848-31008870 TAGCTTCCTGCTGGGGGAGGCGG + Intronic
928502723 2:31914127-31914149 TAGCTTCCTCTCTGGGGCCGTGG - Intronic
928904951 2:36357736-36357758 CAGCCTCGTTTCTGGGGAGGCGG + Intronic
929553694 2:42910462-42910484 TAGAGTCATCTTTGGGGAGGAGG - Intergenic
930048257 2:47192880-47192902 AAGCTTCCCCTCTGGGAATGTGG - Intergenic
930554741 2:52881674-52881696 TTGCTTGCTCTCTGGGGAGATGG + Intergenic
930900415 2:56500160-56500182 TACTTACCTCTCTGGGGAGTGGG + Intergenic
931938308 2:67223202-67223224 TAGCTTCCTCTCTGTGAAATGGG - Intergenic
932191806 2:69747213-69747235 ATGCTACCTCTCTGGGGTGGCGG - Intronic
932479590 2:72031232-72031254 TAGTTTCTTCCCTGGGTAGGGGG - Intergenic
932781551 2:74561684-74561706 CAATCTCCTCTCTGGGGAGGAGG + Intronic
934529458 2:95075979-95076001 CAGATTCCTCTGTGGGGAGATGG - Intergenic
935145929 2:100395479-100395501 CAGCTTCCTCAAAGGGGAGGGGG - Intronic
935435241 2:103024137-103024159 TTGAGTACTCTCTGGGGAGGTGG - Intergenic
936246692 2:110834709-110834731 GAGTTCCCTCTCTGGAGAGGAGG + Intronic
938726008 2:134109483-134109505 TAGCTGCCTCCCTGGGGGGCAGG - Intergenic
939345546 2:140962539-140962561 TAGCTTCTTCTCTGAAGAGGAGG + Intronic
939497049 2:142936814-142936836 TGGCCTACTCTCTGGGGTGGAGG + Intronic
939524775 2:143279074-143279096 TATCTACCTCTCTGGGAAGCTGG + Intronic
939898936 2:147827082-147827104 TAGCTGCCTCCCTGTGGAGTAGG + Intergenic
940625472 2:156170120-156170142 TAGCTTCCTTACTGGAGAGGAGG - Intergenic
941240223 2:163027083-163027105 AAGCTTCCACACTGGGGAAGGGG - Intergenic
941996962 2:171610369-171610391 CTGGTTCCTCTCTGAGGAGGAGG - Intergenic
942449106 2:176098299-176098321 TCTCGTCCTCTCTTGGGAGGTGG - Intergenic
942694162 2:178620263-178620285 TGGCTTTCTCTCTGGAGAGCTGG + Exonic
943651581 2:190463361-190463383 AAGCTTCATTCCTGGGGAGGAGG + Intronic
946252434 2:218421707-218421729 CTGATTTCTCTCTGGGGAGGGGG + Intronic
946734398 2:222740087-222740109 TTGCTTCCTCTCTGGCCATGTGG - Intergenic
948145199 2:235703439-235703461 GAGCTTCCTCTGTGGGTAGTTGG + Intronic
948196269 2:236099032-236099054 TGGCTCCCCCGCTGGGGAGGTGG - Intronic
1168919246 20:1517183-1517205 GAGCTCCCGCTCTGGTGAGGAGG + Intergenic
1169589339 20:7122772-7122794 AGGCTTCATCTCTGGGGTGGAGG + Intergenic
1171986641 20:31665555-31665577 TAGTCTCCTTTCTGGGGAAGAGG + Exonic
1172614040 20:36271903-36271925 TGGCTTCCTCTTTTGGGTGGTGG - Intergenic
1173177675 20:40776967-40776989 CAGCTCCCTCTCTGGCAAGGGGG + Intergenic
1175989789 20:62782701-62782723 AAGCTGCCTCTCTCGGCAGGAGG - Intergenic
1176042478 20:63072705-63072727 TCCCTTCCTCTGTGGGGAGTGGG - Intergenic
1176083754 20:63286577-63286599 TGGCATCCTTGCTGGGGAGGGGG + Intronic
1176740440 21:10596593-10596615 CAGCTTACACTCAGGGGAGGTGG + Intronic
1179015281 21:37590468-37590490 TAGCATGCTCCCGGGGGAGGAGG + Intergenic
1180824695 22:18854428-18854450 AAGCGCCCTCTCTGGGGAGAAGG - Intronic
1181150685 22:20881216-20881238 TGGCAACCTCTCTGGGGAGGTGG + Intronic
1181188036 22:21120119-21120141 AAGCGCCCTCTCTGGGGAGAAGG + Intergenic
1181211162 22:21290374-21290396 AAGCGCCCTCTCTGGGGAGAAGG - Intergenic
1181398341 22:22636514-22636536 AAGCGCCCTCTCTGGGGAGAAGG + Intergenic
1181706308 22:24651193-24651215 AAGCGCCCTCTCTGGGGAGAAGG + Intergenic
1182294289 22:29304117-29304139 TATCCACTTCTCTGGGGAGGAGG - Intergenic
1182477243 22:30582955-30582977 TTGCTTCCTCTCAGCGGATGGGG - Intronic
1182709835 22:32314077-32314099 TATCTCTCACTCTGGGGAGGTGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183449083 22:37881134-37881156 TAGCTTCCTCTCAGGAGGGGAGG + Intronic
1183484766 22:38082873-38082895 TCGCTGCCTCTGTTGGGAGGGGG + Exonic
1184042624 22:41953001-41953023 CAGCTGCCTTTCTGGGGAGCTGG - Intergenic
1184275018 22:43405175-43405197 CAGCATCCTGTTTGGGGAGGGGG - Intergenic
1184586949 22:45454359-45454381 TGGGCTCCTCTGTGGGGAGGTGG - Intergenic
1184779137 22:46637610-46637632 CAGCCTCCTCTGTGGGGAGCAGG - Intronic
1203215785 22_KI270731v1_random:5057-5079 AAGCGCCCTCTCTGGGGAGAAGG + Intergenic
1203274841 22_KI270734v1_random:80334-80356 AAGCGCCCTCTCTGGGGAGAAGG - Intergenic
949684261 3:6549772-6549794 TAGCTTCGTCTTATGGGAGGTGG - Intergenic
949714232 3:6910046-6910068 CAGCTTCCTCATTGGGGAGTTGG + Intronic
951298810 3:20970969-20970991 TAGCAACCTCCTTGGGGAGGAGG + Intergenic
959570568 3:107878774-107878796 CAGCTTCCTCGGTGGGCAGGGGG - Intergenic
961038705 3:123661858-123661880 GTACTTCCTCTCTGGGGAGTCGG + Intronic
961358030 3:126351243-126351265 ATGCTTCCTCCCTGGGGACGTGG - Intronic
961461843 3:127055520-127055542 AAGCTTCCACTGTGGGGAGGGGG + Intergenic
961642417 3:128372964-128372986 TTCCTTCCTGTCTGAGGAGGAGG + Intronic
961781978 3:129325640-129325662 CAGGTCCCTCTCTGTGGAGGAGG - Intergenic
962135827 3:132731095-132731117 TAGTTTCCTCCCTGGCCAGGAGG + Intergenic
962982595 3:140504147-140504169 TAGCTTTCTCTGTGTGGAGCAGG + Intronic
966493052 3:180550606-180550628 TAGCTTACTATCTGGGGAACAGG - Intergenic
966804900 3:183799474-183799496 CAGCTTCCCCTTTGGGGAAGTGG + Intronic
967234081 3:187367708-187367730 TAGCTGCCTCTCTGTGGGGCAGG - Intergenic
967945126 3:194798082-194798104 TTGGTTCCTCTCTGTGGAGTAGG + Intergenic
968512505 4:1001824-1001846 CAACTTCTTCACTGGGGAGGCGG + Exonic
969057024 4:4408409-4408431 TCTCTGCCTCTCTGGGCAGGCGG + Intronic
969228750 4:5815586-5815608 TTTATTCTTCTCTGGGGAGGAGG - Intronic
969579268 4:8054563-8054585 AAGATTCTTCTCTGAGGAGGGGG + Intronic
970385871 4:15555854-15555876 CAGCTTCCTCTCTGGAGAAGGGG - Intronic
970628221 4:17912990-17913012 TAGGGTCCGCTCTGGGGAGGAGG + Intronic
970793470 4:19887608-19887630 TGGCCTGCTCTCTGGGGTGGAGG - Intergenic
972607924 4:40630681-40630703 TTGCCTGCTCTCTGGGGAGTTGG + Intronic
974949410 4:68569999-68570021 TGGCTTGCTCTCTGGGGTGGAGG - Intronic
974958446 4:68672199-68672221 TGGCCTGCTCTCTGGGGTGGAGG - Intergenic
977454944 4:97247177-97247199 TAGCATCCTCTATGGAGAGAGGG - Intronic
978554536 4:109964799-109964821 TAGTTTCCTCTTTGGAGATGAGG + Intronic
979165789 4:117528584-117528606 AAGCTTCCTCTTAGGGGAGATGG - Intergenic
981016230 4:139977305-139977327 TAGATTCTTCTCTGTGGCGGGGG - Intronic
982116883 4:152105437-152105459 TAGCTTTCTTTCTGGGGGTGGGG - Intergenic
983831995 4:172339205-172339227 TACCTTCATCTCAGGGGAGCAGG + Intronic
985961996 5:3309533-3309555 CAGCTTCCTCTCTGGTAAAGGGG + Intergenic
986794296 5:11193703-11193725 TAGCTCCTGCTCTGGGGAGAGGG + Intronic
986893556 5:12338471-12338493 TTGCCTCCTCTTAGGGGAGGTGG + Intergenic
987688695 5:21239465-21239487 TAGCTTCCTCTCAGGGGCTCAGG - Intergenic
988826810 5:34944557-34944579 TTTCTTCCTTTCTGGGGATGGGG - Intronic
990184693 5:53200762-53200784 TGGCCTGCTCTCTGGGGTGGAGG - Intergenic
990494820 5:56337013-56337035 CAGCTTTCTGGCTGGGGAGGTGG - Intergenic
990495559 5:56344288-56344310 TTGCTTCCTCTCTTTGGAGAGGG - Intergenic
991124383 5:63053059-63053081 TAGCTTACCTTCTGGGGAGCTGG - Intergenic
992218911 5:74552504-74552526 TTGCTTCCTCTCTGGTAAGCCGG - Intergenic
992509429 5:77418509-77418531 TAGCTTCCTCTTAGGGGAAAGGG + Intronic
998638704 5:143985688-143985710 GAGCTGCCCCTCTGGGGAGATGG - Intergenic
999108202 5:149092688-149092710 TAGATTCTTCTTTGTGGAGGAGG - Intergenic
1000769190 5:165330559-165330581 GAACTTCCTTTCTGGGGAGCAGG - Intergenic
1001264337 5:170261775-170261797 TAATGTCCTCTCTGGGGAGAAGG + Intronic
1001572792 5:172741582-172741604 AGGCAGCCTCTCTGGGGAGGTGG + Intergenic
1001591583 5:172869180-172869202 GATCTTCCCCCCTGGGGAGGAGG + Intronic
1003177294 6:3761579-3761601 TAGCTGCCTCCCTGCGGAGCAGG + Intergenic
1005959587 6:30685992-30686014 TAGCTTCCAGTCTGGGATGGTGG + Exonic
1006193740 6:32224391-32224413 AAGCATCCTCTCCTGGGAGGAGG - Intergenic
1006741669 6:36313308-36313330 TTGTCTGCTCTCTGGGGAGGAGG - Intergenic
1007372768 6:41437533-41437555 TATCTCCCTTCCTGGGGAGGAGG + Intergenic
1007401763 6:41606707-41606729 TGGCTGTCACTCTGGGGAGGGGG + Intergenic
1008087195 6:47257621-47257643 TAGTTACCTCTTTGGGGAGGGGG + Intronic
1009790736 6:68399139-68399161 TTGGTTCCTCTCTGTGGAAGAGG - Intergenic
1010538791 6:77064465-77064487 TTGGTTCCTCTCTGTGGAAGAGG + Intergenic
1010706498 6:79118005-79118027 GTGCTTGCTATCTGGGGAGGAGG - Intergenic
1012059999 6:94466264-94466286 TAGCTGCCTTTCTTAGGAGGGGG + Intergenic
1013168628 6:107616471-107616493 TAGCTTCCTCTCTGGTCACAAGG + Intronic
1015519187 6:134114455-134114477 TAGTGTCCTGTCTGAGGAGGGGG + Intergenic
1016291980 6:142536929-142536951 TGGCCTGCTCTCTGGGGTGGAGG - Intergenic
1016987376 6:149905463-149905485 GGCCTCCCTCTCTGGGGAGGAGG + Intergenic
1017230303 6:152066556-152066578 AAGCTTCCTCTCCAGGGAGCTGG + Intronic
1018679669 6:166253477-166253499 GAGCTTTCTCCCTGGGGTGGCGG - Intergenic
1019672572 7:2289586-2289608 TTGCTTCCTCTCTGAGGATTGGG - Intronic
1019833842 7:3360771-3360793 TCTCTGCCTCTGTGGGGAGGGGG - Intronic
1022978320 7:35578559-35578581 CAGCTTCTTCTCTGAGGAGTGGG - Intergenic
1023234051 7:38065519-38065541 TAGCTTCCCTTATGGGGAGATGG - Intergenic
1023966397 7:44965147-44965169 CAGCTTCCTCTGTGGAGAGGGGG - Intronic
1026600028 7:71770223-71770245 CAGTTTCCTCTCTGGTCAGGAGG + Intergenic
1026791671 7:73336654-73336676 TAGCCAGCTCTCGGGGGAGGTGG - Intronic
1028476953 7:91264282-91264304 TGGCTTTCGCTCTGGCGAGGAGG + Intergenic
1029533469 7:101141147-101141169 AAGCCTCCTCTGTGGTGAGGGGG - Intergenic
1030606510 7:111644053-111644075 TATCTTCTTCACTGGGGAGAAGG - Intergenic
1031028491 7:116708810-116708832 CATGTTCCTCTTTGGGGAGGAGG + Intronic
1032242915 7:130179336-130179358 TGGCTGCTTCTCTGGGGAAGGGG - Intronic
1032324189 7:130911383-130911405 TTTCTTGCTCTCTTGGGAGGTGG - Intergenic
1033216092 7:139494815-139494837 TTGTTTACTCTCTTGGGAGGAGG - Intergenic
1033273601 7:139955097-139955119 TAGTTTCCTCCCTGGGAAGGAGG - Intronic
1034875839 7:154724230-154724252 TCGCCCCCTCTCTGGGGAGGAGG - Intronic
1035434038 7:158844582-158844604 TGCAATCCTCTCTGGGGAGGTGG + Intergenic
1036236583 8:7044131-7044153 GAGCTCCCTCTCTGGTGAGAGGG + Intergenic
1037725482 8:21479486-21479508 TAGCTGCCTGTTTGGGGAGCTGG - Intergenic
1038916565 8:32031088-32031110 CAGCTGTCTCTTTGGGGAGGTGG + Intronic
1039297209 8:36169485-36169507 TGGCTTCCTCTCTGGGCACAAGG - Intergenic
1040072116 8:43196727-43196749 GAACGCCCTCTCTGGGGAGGAGG - Intronic
1040598530 8:48862761-48862783 TGGCATCCGCTCTGGGGAGTAGG - Intergenic
1041362152 8:57065789-57065811 GAGCATCCTTCCTGGGGAGGAGG - Intergenic
1041713780 8:60915255-60915277 TAGCTTCCTATCTGATGAGTGGG - Intergenic
1041830394 8:62147124-62147146 TTGGTTCTTCTCTGTGGAGGAGG - Intergenic
1042130644 8:65584027-65584049 AAGCTTCCTCCCTGAGGAAGGGG + Intergenic
1042834185 8:73063214-73063236 TAGATTCCTCTCTAAGGAAGTGG - Intergenic
1043552243 8:81387276-81387298 TTTGTTCCTCTCTGTGGAGGAGG + Intergenic
1044843919 8:96361487-96361509 TAACTTCCTCCCTGGAGTGGCGG + Intergenic
1047210494 8:122836380-122836402 TGGCTTGCTCTCCGGGGTGGAGG + Intronic
1048101774 8:131359545-131359567 TTGCTTCCTCTCTGTGAGGGTGG + Intergenic
1048496315 8:134939039-134939061 TTGCTCCCTCTTTAGGGAGGTGG + Intergenic
1048716965 8:137281751-137281773 TGGCCTGCTCTCTGGGGTGGAGG - Intergenic
1049288234 8:141788130-141788152 TCGCCTCCTTTCTGGGGATGCGG - Intergenic
1049607434 8:143536254-143536276 TACCTTCCTTGGTGGGGAGGTGG + Exonic
1051414582 9:16825601-16825623 TAACTTTCTTCCTGGGGAGGAGG + Intronic
1051734645 9:20186082-20186104 TAGCTCACTTTCTGAGGAGGGGG + Intergenic
1055662487 9:78519409-78519431 TTGGTTCCTCTCTGTGGAAGAGG - Intergenic
1056776776 9:89518759-89518781 CCGATTCCTTTCTGGGGAGGGGG + Intergenic
1057158679 9:92868763-92868785 TAATGCCCTCTCTGGGGAGGTGG - Intronic
1057180700 9:93028529-93028551 GCATTTCCTCTCTGGGGAGGAGG - Intronic
1057903771 9:98968786-98968808 TAGCTTCCTGCCTGGGGGCGGGG + Intronic
1058185198 9:101846373-101846395 TAGCTTCATGGCTGGGGAGCTGG + Intergenic
1058528607 9:105884665-105884687 TAGCTTCCTCTGTTGAGAGATGG + Intergenic
1058879508 9:109274265-109274287 TCCCTTCCTCTCTTGGGAGCAGG - Intronic
1059398484 9:114053864-114053886 AAGCTTCCTCACTGGTGATGCGG - Exonic
1061708841 9:132473542-132473564 TACCTTCCTGTCTGTGGAGAGGG + Intronic
1061727889 9:132591065-132591087 CTGCTCCCTCTCTGGGGAGGTGG + Intergenic
1062167667 9:135116051-135116073 TAGCTTCCTCTCTGGGGAGGCGG - Intronic
1186425870 X:9464553-9464575 TGGCTTCCTTTTTGGGGTGGGGG + Intronic
1187815429 X:23226546-23226568 TATGTTCCTCCCTGGAGAGGAGG - Intergenic
1188034274 X:25299084-25299106 TCACTTTCTCTCTGGGGAAGAGG + Intergenic
1191110468 X:56799889-56799911 TGGATTCTTCTCTGGGCAGGGGG + Intergenic
1191947743 X:66554009-66554031 TAGCTTGGACTCTGTGGAGGTGG - Intergenic
1192173260 X:68870041-68870063 AAGCTTCATCTCTGTGGATGTGG + Intergenic
1192492208 X:71585979-71586001 TAGCTTACTGTCTAGGGTGGGGG + Intronic
1192637319 X:72832054-72832076 TTGCTTCCTCTCTGGGGAAGAGG - Intronic
1192644395 X:72888760-72888782 TTGCTTCCTCTCTGGGGAAGAGG + Intronic
1193380385 X:80810020-80810042 TAGCTACAGCTCTGGGAAGGAGG + Intergenic
1195460255 X:105115890-105115912 TAGCTGCCTCTCTGCGGGGCAGG - Intronic
1196310826 X:114162871-114162893 TTGGTTCCTCTTTGTGGAGGAGG + Intergenic
1198715348 X:139552478-139552500 TGGCTTCCTGCCTGGGGAGGGGG - Intronic
1200213499 X:154357196-154357218 AAGCTGCCCCTCTGGGCAGGAGG + Intronic
1201430525 Y:13897417-13897439 TAGCTTCCTCTCTGTGGGGCAGG + Intergenic
1202598719 Y:26570473-26570495 CAGCTTACACTCAGGGGAGGCGG + Intergenic