ID: 1062167764 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:135116530-135116552 |
| Sequence | GCCCTTGATCGCGGGGACCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062167764_1062167772 | 13 | Left | 1062167764 | 9:135116530-135116552 | CCTGGGTCCCCGCGATCAAGGGC | No data | ||
| Right | 1062167772 | 9:135116566-135116588 | TGATGTGTGAACACAGTCAAAGG | No data | ||||
| 1062167764_1062167771 | -10 | Left | 1062167764 | 9:135116530-135116552 | CCTGGGTCCCCGCGATCAAGGGC | No data | ||
| Right | 1062167771 | 9:135116543-135116565 | GATCAAGGGCTTGTTTGTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062167764 | Original CRISPR | GCCCTTGATCGCGGGGACCC AGG (reversed) | Intronic | ||