ID: 1062167764

View in Genome Browser
Species Human (GRCh38)
Location 9:135116530-135116552
Sequence GCCCTTGATCGCGGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062167764_1062167772 13 Left 1062167764 9:135116530-135116552 CCTGGGTCCCCGCGATCAAGGGC No data
Right 1062167772 9:135116566-135116588 TGATGTGTGAACACAGTCAAAGG No data
1062167764_1062167771 -10 Left 1062167764 9:135116530-135116552 CCTGGGTCCCCGCGATCAAGGGC No data
Right 1062167771 9:135116543-135116565 GATCAAGGGCTTGTTTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062167764 Original CRISPR GCCCTTGATCGCGGGGACCC AGG (reversed) Intronic