ID: 1062168762

View in Genome Browser
Species Human (GRCh38)
Location 9:135122588-135122610
Sequence GGCGTGTGCAGGGCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062168762_1062168773 18 Left 1062168762 9:135122588-135122610 CCTGTCTGTGCCCTGCACACGCC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data
1062168762_1062168767 -9 Left 1062168762 9:135122588-135122610 CCTGTCTGTGCCCTGCACACGCC No data
Right 1062168767 9:135122602-135122624 GCACACGCCTCTCCCAGTCGGGG No data
1062168762_1062168766 -10 Left 1062168762 9:135122588-135122610 CCTGTCTGTGCCCTGCACACGCC No data
Right 1062168766 9:135122601-135122623 TGCACACGCCTCTCCCAGTCGGG No data
1062168762_1062168768 -6 Left 1062168762 9:135122588-135122610 CCTGTCTGTGCCCTGCACACGCC No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062168762 Original CRISPR GGCGTGTGCAGGGCACAGAC AGG (reversed) Intergenic
No off target data available for this crispr