ID: 1062168763

View in Genome Browser
Species Human (GRCh38)
Location 9:135122598-135122620
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062168763_1062168773 8 Left 1062168763 9:135122598-135122620 CCCTGCACACGCCTCTCCCAGTC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062168763 Original CRISPR GACTGGGAGAGGCGTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr