ID: 1062168768

View in Genome Browser
Species Human (GRCh38)
Location 9:135122605-135122627
Sequence CACGCCTCTCCCAGTCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062168762_1062168768 -6 Left 1062168762 9:135122588-135122610 CCTGTCTGTGCCCTGCACACGCC No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data
1062168753_1062168768 30 Left 1062168753 9:135122552-135122574 CCAAGCTGCCTAGAACCCCATGG No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data
1062168760_1062168768 14 Left 1062168760 9:135122568-135122590 CCCATGGCAGGGGCTCAGTGCCT No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data
1062168761_1062168768 13 Left 1062168761 9:135122569-135122591 CCATGGCAGGGGCTCAGTGCCTG No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data
1062168758_1062168768 22 Left 1062168758 9:135122560-135122582 CCTAGAACCCCATGGCAGGGGCT No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data
1062168759_1062168768 15 Left 1062168759 9:135122567-135122589 CCCCATGGCAGGGGCTCAGTGCC No data
Right 1062168768 9:135122605-135122627 CACGCCTCTCCCAGTCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062168768 Original CRISPR CACGCCTCTCCCAGTCGGGG TGG Intergenic
No off target data available for this crispr