ID: 1062168769

View in Genome Browser
Species Human (GRCh38)
Location 9:135122609-135122631
Sequence GTGGCCACCCCGACTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062168769_1062168773 -3 Left 1062168769 9:135122609-135122631 CCTCTCCCAGTCGGGGTGGCCAC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062168769 Original CRISPR GTGGCCACCCCGACTGGGAG AGG (reversed) Intergenic
No off target data available for this crispr